View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8180A_low_259 (Length: 238)
Name: NF8180A_low_259
Description: NF8180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8180A_low_259 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 13 - 219
Target Start/End: Original strand, 4817611 - 4817817
Alignment:
| Q |
13 |
ccaagaatatcaagaacaatggcaaagtctacaatcccccttgtcttcaccctttgctttttatccttcttaggttcggcttattccaagtctgatcgct |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4817611 |
ccaacaatatcaagaacaatggcaaagtctacaatcccccttgtcttcaccctttgctttttatccttcttaggttcggcttattccaagtctgatcgct |
4817710 |
T |
 |
| Q |
113 |
tctttgtagaaggtgttgtttactgtgacacatgtcgcacccaattcatcaccagattgaccgagttcattgaaggtacgcgcatattttttaacatgaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4817711 |
tctttgtagaaggtgttgtttactgtgacacatgtcgcacccaattcatcaccagattgaccgagttcattgaaggtacgtacatattttttaacatgaa |
4817810 |
T |
 |
| Q |
213 |
tctatga |
219 |
Q |
| |
|
||||||| |
|
|
| T |
4817811 |
tctatga |
4817817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University