View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8180A_low_271 (Length: 234)
Name: NF8180A_low_271
Description: NF8180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8180A_low_271 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 14 - 222
Target Start/End: Original strand, 6201117 - 6201325
Alignment:
| Q |
14 |
gacatcaacaaaagaaaataaagaaagagttatttctaaccgagtcataaggagggtgggtagggaatttgaaaactcgtagaagacatttgttaaggag |
113 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6201117 |
gacataaacaaaagtaaataaagaaagagttatttctaaccgagtcataaggagggtgggtagggaatttgaaaactcgtagaagacatttgttaaggag |
6201216 |
T |
|
| Q |
114 |
ggaagagaggaatggacagtggatcgtggagctgggttctaatgctgcaatacgtaacaagagagacttcatgctttgatcttgcatcattgtgtgcctc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6201217 |
ggaagagaggaatggacagtggatcgtggagctgggttctaatgatgcaatacgtaacaagagagacttcatgctttgatcttgcatcattgtgtgcctc |
6201316 |
T |
|
| Q |
214 |
tgtgcttct |
222 |
Q |
| |
|
|||| |||| |
|
|
| T |
6201317 |
tgtgtttct |
6201325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 14 - 214
Target Start/End: Original strand, 43367412 - 43367613
Alignment:
| Q |
14 |
gacatcaacaaaagaaaataaagaaagagtta-tttctaaccgagtcataaggagggtgggtagggaatttgaaaactcgtagaagacatttgttaagga |
112 |
Q |
| |
|
||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||| || ||| ||||||||| |||| ||||||| | ||||| || |
|
|
| T |
43367412 |
gacataaacaaaagaaaataaagaaagagttagtttctaaccgagtcataaggagggtgagtgggggatttgaaaattcgttgaagacaatggttaacga |
43367511 |
T |
|
| Q |
113 |
gggaagagaggaatggacagtggatcgtggagctgggttctaatgctgcaatacgtaacaagagagacttcatgctttgatcttgcatcattgtgtgcct |
212 |
Q |
| |
|
|||| ||||||| |||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||| ||| |||||||| |
|
|
| T |
43367512 |
gggaggagaggagtggacagtggatcgtgtagctgggttctaatgctgcaatacgcaacaagagagacttcatcctttgatcttgcagcatggtgtgcct |
43367611 |
T |
|
| Q |
213 |
ct |
214 |
Q |
| |
|
|| |
|
|
| T |
43367612 |
ct |
43367613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University