View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8180A_low_274 (Length: 233)
Name: NF8180A_low_274
Description: NF8180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8180A_low_274 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 11 - 233
Target Start/End: Complemental strand, 32103698 - 32103476
Alignment:
| Q |
11 |
gttttagatatgattaaatattgcagagaaatgaaagaaaaaactgtttggtaatgactgaatgaataaagaatggcggctccatctccattaggcagta |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32103698 |
gttttagatatgattaaatattgcagagaaatgaaagaaaaaactgtttggtaatgactgaatgaataaagaatggctgctccatctccattaggcagta |
32103599 |
T |
|
| Q |
111 |
agcttcaaaacatgttgcaggctgcggtgcaatctgttcagtggacttatagcctcttctggcaactttgcccacaacaactgtacgtcatcattttctt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32103598 |
agcttcaaaacatgttgcaggctgcggtgcaatctgttcagtggacttatagcctcttctggcaactttgcccacaacaactgtacgtcatcattttctt |
32103499 |
T |
|
| Q |
211 |
ttcctcttcctcactcactatat |
233 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
32103498 |
ttcctcttcctcactcactatat |
32103476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University