View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8180A_low_277 (Length: 233)
Name: NF8180A_low_277
Description: NF8180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8180A_low_277 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 59; Significance: 4e-25; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 20 - 90
Target Start/End: Complemental strand, 26495475 - 26495405
Alignment:
| Q |
20 |
caagtatgaaggttatctgcaagcttagaatttgcttttaaccataaaaaagaaagttgtttaacgttatc |
90 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||| || ||||||||||| |
|
|
| T |
26495475 |
caagtatgaaggttatctgcaagcttagaatttgcttttaaccaaaaaaaagaaagctgcttaacgttatc |
26495405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 177 - 222
Target Start/End: Complemental strand, 26495400 - 26495355
Alignment:
| Q |
177 |
aacttaagaatcgaagaagctttattgttaaaaattatattcttcg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
26495400 |
aacttaagaatcgaagaagctttattgttaaaaattctattgttcg |
26495355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University