View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8180A_low_279 (Length: 232)
Name: NF8180A_low_279
Description: NF8180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8180A_low_279 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 59; Significance: 4e-25; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 57 - 143
Target Start/End: Original strand, 2412488 - 2412574
Alignment:
| Q |
57 |
tagatacatcccaaatgatgcgggaattatctcccagagtggtgaaataattatcttccttttaggcacaaaatatagcggtgatcg |
143 |
Q |
| |
|
||||||||||||||| | | |||||||||||| | ||||||||||||||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
2412488 |
tagatacatcccaaaagtttcgggaattatcttctagagtggtgaaataattatcttccttttatgcacaaaatatagtggtgatcg |
2412574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 2411197 - 2411261
Alignment:
| Q |
1 |
gaagtgtttgaaagtgagcttaggaaaactgttttacccctaatgtatatgtatgatagatacat |
65 |
Q |
| |
|
|||| |||||||||| | ||| ||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
2411197 |
gaagggtttgaaagttatcttcggaaaactgttttacccgtaatgtatatgtatgatagatacat |
2411261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University