View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8180A_low_279 (Length: 232)

Name: NF8180A_low_279
Description: NF8180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8180A_low_279
NF8180A_low_279
[»] chr2 (2 HSPs)
chr2 (57-143)||(2412488-2412574)
chr2 (1-65)||(2411197-2411261)


Alignment Details
Target: chr2 (Bit Score: 59; Significance: 4e-25; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 57 - 143
Target Start/End: Original strand, 2412488 - 2412574
Alignment:
57 tagatacatcccaaatgatgcgggaattatctcccagagtggtgaaataattatcttccttttaggcacaaaatatagcggtgatcg 143  Q
    ||||||||||||||| | | |||||||||||| | ||||||||||||||||||||||||||||| ||||||||||||| ||||||||    
2412488 tagatacatcccaaaagtttcgggaattatcttctagagtggtgaaataattatcttccttttatgcacaaaatatagtggtgatcg 2412574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 2411197 - 2411261
Alignment:
1 gaagtgtttgaaagtgagcttaggaaaactgttttacccctaatgtatatgtatgatagatacat 65  Q
    |||| |||||||||| | ||| ||||||||||||||||| |||||||||||||||||||||||||    
2411197 gaagggtttgaaagttatcttcggaaaactgttttacccgtaatgtatatgtatgatagatacat 2411261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University