View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8180A_low_28 (Length: 414)
Name: NF8180A_low_28
Description: NF8180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8180A_low_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 52; Significance: 1e-20; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 7 - 107
Target Start/End: Original strand, 8955680 - 8955778
Alignment:
| Q |
7 |
aaactcaccaaccgataaaaactacgatgtttgttcgacctaatcaaagcagagaagatataagaacttatctttcnnnnnnnaatgacaaaataagata |
106 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| | ||||| |||||||||||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
8955680 |
aaactcaccaaccgataaaaactacgatggttgttctatctaat-aaagcagagaagatataagaacttat-tttcttttttaaatgacaaaataagata |
8955777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 107 - 144
Target Start/End: Original strand, 8956052 - 8956089
Alignment:
| Q |
107 |
tatatagataatactgaaattgtggagtgatcccgaga |
144 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
8956052 |
tatatagataatactgaaattgaggagtgatcccgaga |
8956089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 259 - 366
Target Start/End: Complemental strand, 17275104 - 17274997
Alignment:
| Q |
259 |
acaaagtgctacaggatttgattagaagtaattaacagagtttgtgactattttgtcctaaagatcgacaagactctaaaccacttgtaaacaaatcacc |
358 |
Q |
| |
|
||||||| ||||| | |||||| | ||||||||||| || |||||||| ||| | |||||||||| |||||| ||||||||| |||| | |||||| |
|
|
| T |
17275104 |
acaaagttctacaaggtttgataacaagtaattaacgaagcttgtgactctttagccctaaagatcaccaagaccctaaaccacatgtagcaagatcacc |
17275005 |
T |
 |
| Q |
359 |
ttcaactt |
366 |
Q |
| |
|
|||||||| |
|
|
| T |
17275004 |
ttcaactt |
17274997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University