View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8180A_low_281 (Length: 231)
Name: NF8180A_low_281
Description: NF8180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8180A_low_281 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 7 - 195
Target Start/End: Complemental strand, 16691422 - 16691234
Alignment:
| Q |
7 |
gaatcatagtgttttcgctgcaacatggaacgttggaggtcaatgcccaagtgggaaccttgatctgagtgattttcttcaggttcgaaatgagccggat |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16691422 |
gaatcatagtgttttcgctgcaacatggaacgttggaggtcaatgcccaagtgggaaccttgatctgagtgattttcttcaggttcgaaatgagccggat |
16691323 |
T |
 |
| Q |
107 |
atgtatgttttggggtatgctctctttatctctgcacgctcgcgcgtgtgtcatgatttctgattttaattcatgaaaaagttcgtaaa |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
16691322 |
atgtatgttttggggtatgctctctttatctctgcacgctcgcgtgtgtgtcatgatttttgattttaattcatgaaaaagttcgtaaa |
16691234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University