View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8180A_low_282 (Length: 230)
Name: NF8180A_low_282
Description: NF8180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8180A_low_282 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 131 - 230
Target Start/End: Complemental strand, 49155994 - 49155895
Alignment:
| Q |
131 |
tggatgctgagtttgatgctttataattattggaagaaatgtatttagtgttatgagctattggttgtctgcatcctgctatcaattggatgaataatga |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49155994 |
tggatgctgagtttgatgctttataattattggaagaaatggatttagtgttatgagctattggttgtctgcatcctgctatcaattggatgaataatga |
49155895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 1 - 93
Target Start/End: Complemental strand, 49156122 - 49156030
Alignment:
| Q |
1 |
ttgcggtttgaattttaagttgcgtttcatggatctatatgtgtttttcctcattatgtatttccgtaattcattaagatttgattctcttga |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
49156122 |
ttgcggtttgaattttaagttgcgtttcatggatctagatgtgtttttcctcattatgtaattacgtaattcattaagatttgattctcttga |
49156030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 139 - 196
Target Start/End: Complemental strand, 39266089 - 39266032
Alignment:
| Q |
139 |
gagtttgatgctttataattattggaagaaatgtatttagtgttatgagctattggtt |
196 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||| |||||||||||||| |||| |||| |
|
|
| T |
39266089 |
gagtttgatgctttataattgttggaagagatgaatttagtgttatgaactataggtt |
39266032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University