View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8180A_low_284 (Length: 230)
Name: NF8180A_low_284
Description: NF8180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8180A_low_284 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 47 - 197
Target Start/End: Original strand, 34570946 - 34571096
Alignment:
| Q |
47 |
aacatcctggtcaaatggaccgtcaaaatcaaaaacttccacatacaaaactgatggtggttcttccatagcatcaaactctaatatctctgcatattag |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34570946 |
aacatcctggtcaaatggaccgtcaaaatcaaaaacttccacatacaaaactgatggtggttcttccatagcatcaaactctaatatctctgcatattag |
34571045 |
T |
 |
| Q |
147 |
tatataaaaccaatacagaatataagtaaataaacattcaaattgaaacaa |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
34571046 |
tatataaaaccaatacagaatataagtaaagaaacattcaaattgaaacaa |
34571096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University