View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8180A_low_300 (Length: 229)
Name: NF8180A_low_300
Description: NF8180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8180A_low_300 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 112 - 214
Target Start/End: Original strand, 7741341 - 7741443
Alignment:
| Q |
112 |
gttcaccattttgtattccttgatgcctttatcatcttctacaagttactgtttttaatatcacttcttttaattaatatccaatcaatcgctaaagtat |
211 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
7741341 |
gttcaccattttgtattccttggtgcctttatcatcttctacaacttactgtttttaatatcacttcttttaattaatatccaatcaatcgataaagtat |
7741440 |
T |
|
| Q |
212 |
tat |
214 |
Q |
| |
|
||| |
|
|
| T |
7741441 |
tat |
7741443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 3 - 84
Target Start/End: Original strand, 7741232 - 7741313
Alignment:
| Q |
3 |
caatgagatggacatcattgataatccaatcacaactttgcccctaccttttatatttcatcatctgctcctcattctctcg |
84 |
Q |
| |
|
|||||| ||||| | |||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
7741232 |
caatgaaatggaaaacattgataatacaatcacaactttgcccctaccttttatatttcatcatctgcttctcattctctcg |
7741313 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 59; Significance: 4e-25; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 113 - 214
Target Start/End: Complemental strand, 36657510 - 36657409
Alignment:
| Q |
113 |
ttcaccattttgtattccttgatgcctttatcatcttctacaagttactg-tttttaatatcacttcttttaattaatatccaatcaatcgctaaagtat |
211 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||||||||||||| ||| || ||||||||| ||||||||||||||||||| ||||||| || |||||||| |
|
|
| T |
36657510 |
ttcaccgttttgtattccttggtgcctttatcatcttctacaacttattgttttttaataccacttcttttaattaatat-caatcaaccgataaagtat |
36657412 |
T |
|
| Q |
212 |
tat |
214 |
Q |
| |
|
||| |
|
|
| T |
36657411 |
tat |
36657409 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 75
Target Start/End: Complemental strand, 36657589 - 36657533
Alignment:
| Q |
19 |
attgataatccaatcacaactttgcccctaccttttatatttcatcatctgctcctc |
75 |
Q |
| |
|
|||| |||| ||||||||| |||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
36657589 |
attgttaatacaatcacaattttgcccctaccttttctatttcatcatttgctcctc |
36657533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University