View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8180A_low_303 (Length: 228)
Name: NF8180A_low_303
Description: NF8180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8180A_low_303 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 197
Target Start/End: Original strand, 44988688 - 44988884
Alignment:
| Q |
1 |
taaaattcgctagattcacaagcttgaggacgattgaacatgtctagaacataatggttatttattttctcccagacatgtttaaaacaatagtgacttt |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44988688 |
taaaattagctagattcacaagcttgaggacgattgaacatgtctagaacataatggttatttattttctcccagacatgtttaaaacaatagtgacttt |
44988787 |
T |
|
| Q |
101 |
gaaccttgtagtttatcgatttggaacttgttgtgtgctcggttatcttttggtttattctttagtaactttgaaccttgtaatttatcgatttgga |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
44988788 |
gaaccttgtagtttatcgatttggaacttgctgtgtgctcggttatcttttggtttattctttagtaactttgaaccttgtaatttattgatttgga |
44988884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 158 - 197
Target Start/End: Original strand, 44988893 - 44988932
Alignment:
| Q |
158 |
ttctttagtaactttgaaccttgtaatttatcgatttgga |
197 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
44988893 |
ttctctagtaactttgaaccttgtaatttatcgatttgga |
44988932 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University