View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8180A_low_305 (Length: 228)
Name: NF8180A_low_305
Description: NF8180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8180A_low_305 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 16 - 95
Target Start/End: Original strand, 765460 - 765539
Alignment:
| Q |
16 |
acatcaagggaaaaacaatgtggggacgaatttaattttgttttgtgaatggttgatgattgtggttggaaaagatacca |
95 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
765460 |
acataaagggaaaaacaatgtggggacgaatttaattttgttttgtgaatggttgatgattgtggttggaaaagatacca |
765539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 158 - 212
Target Start/End: Original strand, 765602 - 765656
Alignment:
| Q |
158 |
ggtgggagggcagattttattttgctttgttaatattggtagatctttgatactc |
212 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
765602 |
ggtgggagggcaaattttattttgctttgttaatattggtagatctttgatactc |
765656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University