View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8180A_low_307 (Length: 227)

Name: NF8180A_low_307
Description: NF8180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8180A_low_307
NF8180A_low_307
[»] chr3 (2 HSPs)
chr3 (31-128)||(19143236-19143334)
chr3 (185-220)||(19143146-19143181)


Alignment Details
Target: chr3 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 31 - 128
Target Start/End: Complemental strand, 19143334 - 19143236
Alignment:
31 tgatgtagggtacagtttcagggtggaa-caaatttactatctagacattctttggagtaaaaagctaaatatttcaaaatcctaatcaaaatgtcttc 128  Q
    |||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
19143334 tgatgtagggtacagtttcagggtggaaacaaatgtactatctagacattctttggagtaaaaagccaaatatttcaaaatcctaatcaaaatgtcttc 19143236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 220
Target Start/End: Complemental strand, 19143181 - 19143146
Alignment:
185 ttgtagcttgagaattttgcgtgtaaacttttatat 220  Q
    ||||||||||||||||||||||||||||||||||||    
19143181 ttgtagcttgagaattttgcgtgtaaacttttatat 19143146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University