View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8180A_low_307 (Length: 227)
Name: NF8180A_low_307
Description: NF8180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8180A_low_307 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 31 - 128
Target Start/End: Complemental strand, 19143334 - 19143236
Alignment:
| Q |
31 |
tgatgtagggtacagtttcagggtggaa-caaatttactatctagacattctttggagtaaaaagctaaatatttcaaaatcctaatcaaaatgtcttc |
128 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
19143334 |
tgatgtagggtacagtttcagggtggaaacaaatgtactatctagacattctttggagtaaaaagccaaatatttcaaaatcctaatcaaaatgtcttc |
19143236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 220
Target Start/End: Complemental strand, 19143181 - 19143146
Alignment:
| Q |
185 |
ttgtagcttgagaattttgcgtgtaaacttttatat |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
19143181 |
ttgtagcttgagaattttgcgtgtaaacttttatat |
19143146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University