View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8180A_low_317 (Length: 225)
Name: NF8180A_low_317
Description: NF8180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8180A_low_317 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 8 - 219
Target Start/End: Complemental strand, 20086181 - 20085970
Alignment:
| Q |
8 |
tgagagacaaattttcatgttttagtgaaaattcaataaatgtctcaaatgcttcatgttctagctattcaaacaacacatgcatttcaccaaacgttgt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
20086181 |
tgagagacaaattttcatgttttagtgaaaattcaataaatgtctcaaatgcttcatgttctagctattcaaacaacacatgcatttcaccaaatgttgt |
20086082 |
T |
|
| Q |
108 |
ttcaccttcaatccaaaactcaatctcaagtgtttacaaattagtcctttcaacattgaaacaccttttgatcactgttacatggtgtaaaaatcactca |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20086081 |
ttcaccttcaatccaaaactcaatctcaagtgtttacaaattagtcctttcaacattgaaacaccttttgatcactgttacatggtgtaaaaatcactca |
20085982 |
T |
|
| Q |
208 |
aatcaaggactt |
219 |
Q |
| |
|
|||||||||||| |
|
|
| T |
20085981 |
aatcaaggactt |
20085970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 101 - 168
Target Start/End: Complemental strand, 1021525 - 1021458
Alignment:
| Q |
101 |
acgttgtttcaccttcaatccaaaactcaatctcaagtgtttacaaattagtcctttcaacattgaaa |
168 |
Q |
| |
|
||||||||||||||||||| ||||||| ||| ||||||||||| ||||| ||||| |||||||||||| |
|
|
| T |
1021525 |
acgttgtttcaccttcaattcaaaacttaatttcaagtgtttagaaattggtcctctcaacattgaaa |
1021458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University