View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8180A_low_322 (Length: 223)
Name: NF8180A_low_322
Description: NF8180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8180A_low_322 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 22 - 206
Target Start/End: Original strand, 19190435 - 19190619
Alignment:
| Q |
22 |
gcgctaatgaccgttacgagagtggatatgggcgttctgggggtggatatggtgatggagggcgtacgagtattggtggatatggcgaagaaaaccgttc |
121 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
19190435 |
gcgctaatgaccgttatgagagtggatatgggcgttctggtggtggatatggtgatggagggcgttcgagtattggtggatatggcgaagaaaaccgttc |
19190534 |
T |
 |
| Q |
122 |
tagtggtggctatggatatggagggcgttctagtggttacggtaatgagcaaagttttggagggtatggtaggggtggtcgtgat |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
19190535 |
tagtggtggctatggatatggagggcgttctagtggttacggtaatgagcaaagttttggagggtatggtagggatggtcgtgat |
19190619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University