View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8180A_low_325 (Length: 222)
Name: NF8180A_low_325
Description: NF8180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8180A_low_325 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 74; Significance: 4e-34; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 20 - 109
Target Start/End: Complemental strand, 13650434 - 13650345
Alignment:
| Q |
20 |
aataataaataacctatggttattaacactccgatcccagagtacagattaaactaaaaaccaaaaatcaaataagaactagaggcatta |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
13650434 |
aataataaataacctatggttattaacactctgatcccagagtatagattaaactaaaaaccaacaatcaaataagaaccagaggcatta |
13650345 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 56 - 183
Target Start/End: Complemental strand, 41883890 - 41883758
Alignment:
| Q |
56 |
ccagagtacagattaaactaaaaa-ccaaaaatcaaataagaactagaggcattaattctactcaattaacaacaat----atagtaagggaagattttc |
150 |
Q |
| |
|
|||||||| |||| |||||||||| || | |||| |||| ||||||||||||||| ||||| ||||||||||||||| ||||||| ||||| ||||| |
|
|
| T |
41883890 |
ccagagtatagatcaaactaaaaaaccgacaatctaatacgaactagaggcattagttctattcaattaacaacaatctatatagtaaaggaagtttttc |
41883791 |
T |
|
| Q |
151 |
agtgtcacaaattcaccaaaaactctagccaaa |
183 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
41883790 |
agtgtcacaaattcaccaaaaactatagccaaa |
41883758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University