View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8180A_low_328 (Length: 221)
Name: NF8180A_low_328
Description: NF8180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8180A_low_328 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 23 - 221
Target Start/End: Complemental strand, 46421340 - 46421143
Alignment:
| Q |
23 |
atgaaccatatatcttttcttcaacatatgaaagaggaagatgaaggcttttcaggatatccggacttgcttctctggaggcagaaattgtcttcttcaa |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46421340 |
atgaaccatatatcttttcttcaacatatgaaagaggaagatgaaggcttttcaggatatccagacttgcttctctggaggcagaaattgtcttcttcaa |
46421241 |
T |
 |
| Q |
123 |
gacttgcctctgaagatattgcaagggacatattttctgtcggctgtctcttggcagaacttcatctttgcagaccgctatttgatgtcaatctcattg |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
46421240 |
gacttgcctctgaagatattgcaagggacatattttctgtcggctgtctcttggcagaacttcatctttgcagaccgctatttgat-tcaatctcattg |
46421143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University