View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8180A_low_339 (Length: 217)
Name: NF8180A_low_339
Description: NF8180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8180A_low_339 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 36335474 - 36335268
Alignment:
| Q |
1 |
taatgtatataagaaaaacagctctggtgtggtttttaatgaagtctctttgaacccgacacttttgattagatgtgtgttcaacgtccgacatgtgttg |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||| | || | ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
36335474 |
taatgtatataagaaaaacagctctagtgtataatgtag-gcagtctctttgaacccgacacttttgattagatgtgtgttcaacgtccaacatgtgttg |
36335376 |
T |
 |
| Q |
101 |
gtgtcagacacagacaccaacacatacggatataattacgtttgattaattaattttctcaaatttatcagtgtcgatgtgttagtgtcattactcatta |
200 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36335375 |
gtgtcagacac------caacacatacggatataattacgttggattaattaattttctcaaatttatcagtgtcgatgtgttagtgtcattactcatta |
36335282 |
T |
 |
| Q |
201 |
tcatgtccgtgtct |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
36335281 |
tcatgtccgtgtct |
36335268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University