View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8180A_low_343 (Length: 215)
Name: NF8180A_low_343
Description: NF8180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8180A_low_343 |
 |  |
|
| [»] scaffold0484 (2 HSPs) |
 |  |  |
|
| [»] scaffold0049 (2 HSPs) |
 |  |  |
|
| [»] scaffold0262 (1 HSPs) |
 |  |  |
|
| [»] scaffold0408 (1 HSPs) |
 |  |  |
|
| [»] scaffold0071 (2 HSPs) |
 |  |  |
|
| [»] scaffold0197 (1 HSPs) |
 |  |  |
|
| [»] scaffold0471 (1 HSPs) |
 |  |  |
|
| [»] scaffold0061 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 55; Significance: 9e-23; HSPs: 7)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 13 - 75
Target Start/End: Complemental strand, 24093059 - 24092997
Alignment:
| Q |
13 |
cgaagaatatgatgtgataaaactaaagtgattaaaatattcatgtctccataattgtaacat |
75 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24093059 |
cgaataatatgatgtgataaaactaaagtgattaaaatactcatgtctccataattgtaacat |
24092997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 76 - 130
Target Start/End: Original strand, 29042336 - 29042390
Alignment:
| Q |
76 |
gggttaataggcttttaccccctgccatttgggggtcttttggtataccccctat |
130 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
29042336 |
gggttaataggcttttaccccctgctatttgggggtcttttggtatacctcctat |
29042390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 74 - 130
Target Start/End: Complemental strand, 29043674 - 29043618
Alignment:
| Q |
74 |
atgggttaataggcttttaccccctgccatttgggggtcttttggtataccccctat |
130 |
Q |
| |
|
||||||||||||||||||| ||| |||||||| ||||||||||||| |||||||||| |
|
|
| T |
29043674 |
atgggttaataggcttttatcccgtgccatttaggggtcttttggtgtaccccctat |
29043618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 148 - 197
Target Start/End: Original strand, 29042401 - 29042450
Alignment:
| Q |
148 |
cttggagattccccctcgtaaaatgaagattctttggtttacacccctga |
197 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||||| ||||| |
|
|
| T |
29042401 |
cttggagattcccccttgaaaaatgaagattctttggtttacacacctga |
29042450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 75 - 128
Target Start/End: Original strand, 30776465 - 30776519
Alignment:
| Q |
75 |
tgggttaataggctttta-ccccctgccatttgggggtcttttggtataccccct |
128 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||| || ||||||||| ||||||| |
|
|
| T |
30776465 |
tgggttaataggcttttacccccctaccatttggaggacttttggtagaccccct |
30776519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 160 - 201
Target Start/End: Complemental strand, 29043597 - 29043556
Alignment:
| Q |
160 |
ccctcgtaaaatgaagattctttggtttacacccctgatgtc |
201 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
29043597 |
cccttgtaaaatgaagattatttggtttacacccttgatgtc |
29043556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 75 - 119
Target Start/End: Original strand, 25648620 - 25648664
Alignment:
| Q |
75 |
tgggttaataggcttttaccccctgccatttgggggtcttttggt |
119 |
Q |
| |
|
||||||||||||||||||| ||||||||||| || | |||||||| |
|
|
| T |
25648620 |
tgggttaataggcttttactccctgccatttaggagacttttggt |
25648664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 55; Significance: 9e-23; HSPs: 28)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 74 - 128
Target Start/End: Original strand, 9008759 - 9008813
Alignment:
| Q |
74 |
atgggttaataggcttttaccccctgccatttgggggtcttttggtataccccct |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9008759 |
atgggttaataggcttttaccccctgccatttgggggtcttttggtataccccct |
9008813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 148 - 201
Target Start/End: Original strand, 35712520 - 35712573
Alignment:
| Q |
148 |
cttggagattccccctcgtaaaatgaagattctttggtttacacccctgatgtc |
201 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35712520 |
cttggagattcccccttgtaaaatgaagattctttggtttacacccctgatgtc |
35712573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 79 - 130
Target Start/End: Original strand, 43402266 - 43402317
Alignment:
| Q |
79 |
ttaataggcttttaccccctgccatttgggggtcttttggtataccccctat |
130 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
43402266 |
ttaataggcttttaccccctgccatttgggggtcttttggtttaccccctat |
43402317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 76 - 126
Target Start/End: Complemental strand, 48030290 - 48030240
Alignment:
| Q |
76 |
gggttaataggcttttaccccctgccatttgggggtcttttggtatacccc |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
48030290 |
gggttaataggcttttaccccctgccatttgggggtcttttgatatacccc |
48030240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 148 - 197
Target Start/End: Complemental strand, 35713682 - 35713633
Alignment:
| Q |
148 |
cttggagattccccctcgtaaaatgaagattctttggtttacacccctga |
197 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
35713682 |
cttggagattcccccttgtaaaatgaagattctttggtttacacccctga |
35713633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 76 - 127
Target Start/End: Original strand, 17240717 - 17240769
Alignment:
| Q |
76 |
gggttaataggcttttacccc-ctgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
17240717 |
gggttaataggcttttacccccctgccatttgggggtcttttggtataccccc |
17240769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 76 - 127
Target Start/End: Complemental strand, 51676389 - 51676338
Alignment:
| Q |
76 |
gggttaataggcttttaccccctgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
51676389 |
gggttaatagacttttaccccctgctatttgggggtcttttggtataccccc |
51676338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 76 - 127
Target Start/End: Original strand, 21747943 - 21747995
Alignment:
| Q |
76 |
gggttaataggcttttacccc-ctgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
21747943 |
gggttaataggcttttacccccctgccatttgggggtcttttggtttaccccc |
21747995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 75 - 127
Target Start/End: Original strand, 42097325 - 42097378
Alignment:
| Q |
75 |
tgggttaataggcttttacccc-ctgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
42097325 |
tgggttaataggtttttacccccctgccatttgggggtcttttggtttaccccc |
42097378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 76 - 127
Target Start/End: Complemental strand, 17242157 - 17242105
Alignment:
| Q |
76 |
gggttaataggcttttaccccc-tgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
17242157 |
gggttaataggcttttacccccctgccatttgggggctttttggtataccccc |
17242105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 76 - 127
Target Start/End: Complemental strand, 35713749 - 35713697
Alignment:
| Q |
76 |
gggttaataggcttttaccccc-tgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
|||||||| ||||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
35713749 |
gggttaatgggcttttacccccctgccatatgggggtcttttggtataccccc |
35713697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 76 - 119
Target Start/End: Complemental strand, 42098784 - 42098740
Alignment:
| Q |
76 |
gggttaataggcttttaccccc-tgccatttgggggtcttttggt |
119 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
42098784 |
gggttaataggcttttacccccctgccatttgggggtcttttggt |
42098740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 76 - 127
Target Start/End: Complemental strand, 43403351 - 43403299
Alignment:
| Q |
76 |
gggttaataggctttta-ccccctgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
43403351 |
gggttaataggcttttatccccctgtcatttgggggtcttttggtttaccccc |
43403299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 76 - 127
Target Start/End: Complemental strand, 9011111 - 9011061
Alignment:
| Q |
76 |
gggttaataggcttttaccccctgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
9011111 |
gggttaataggtttttaccccctgccatttggggct-ttttggtataccccc |
9011061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 77 - 124
Target Start/End: Complemental strand, 30232786 - 30232739
Alignment:
| Q |
77 |
ggttaataggcttttaccccctgccatttgggggtcttttggtatacc |
124 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||||||| |||||| |
|
|
| T |
30232786 |
ggttaataggcttttaccccctgctatttgagggtcttttgatatacc |
30232739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 79 - 130
Target Start/End: Original strand, 31720542 - 31720593
Alignment:
| Q |
79 |
ttaataggcttttaccccctgccatttgggggtcttttggtataccccctat |
130 |
Q |
| |
|
||||||| |||||| |||| | |||||||||||||||||||||||||||||| |
|
|
| T |
31720542 |
ttaatagacttttatcccccgtcatttgggggtcttttggtataccccctat |
31720593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 77 - 128
Target Start/End: Original strand, 49383023 - 49383074
Alignment:
| Q |
77 |
ggttaataggcttttaccccctgccatttgggggtcttttggtataccccct |
128 |
Q |
| |
|
||||||||| ||||||||||||||||||| |||| |||||||| |||||||| |
|
|
| T |
49383023 |
ggttaatagacttttaccccctgccatttaggggacttttggtttaccccct |
49383074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 76 - 126
Target Start/End: Original strand, 24302936 - 24302985
Alignment:
| Q |
76 |
gggttaataggcttttaccccctgccatttgggggtcttttggtatacccc |
126 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
24302936 |
gggttaataggattttaccccctgccattt-ggggtcttttggtttacccc |
24302985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 149 - 194
Target Start/End: Original strand, 13970018 - 13970062
Alignment:
| Q |
149 |
ttggagattccccctcgtaaaatgaagattctttggtttacacccc |
194 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
13970018 |
ttggagattccccct-gtaaaatgaagattctttggtttatacccc |
13970062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 76 - 127
Target Start/End: Complemental strand, 13971056 - 13971004
Alignment:
| Q |
76 |
gggttaataggcttttac-cccctgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||| |||||||||| ||||||| |
|
|
| T |
13971056 |
gggttaataggtttttactcccctgccatttgggagtcttttggtttaccccc |
13971004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 76 - 127
Target Start/End: Complemental strand, 21749341 - 21749290
Alignment:
| Q |
76 |
gggttaataggcttttaccccctgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
||||||||||||||||||||||| |||| || | |||||||||| ||||||| |
|
|
| T |
21749341 |
gggttaataggcttttaccccctaccatatgtgcgtcttttggtttaccccc |
21749290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 201
Target Start/End: Complemental strand, 30232718 - 30232683
Alignment:
| Q |
166 |
taaaatgaagattctttggtttacacccctgatgtc |
201 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |
|
|
| T |
30232718 |
taaaatgaagattctttggtttacacccttgatgtc |
30232683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 75 - 109
Target Start/End: Complemental strand, 24304360 - 24304326
Alignment:
| Q |
75 |
tgggttaataggcttttaccccctgccatttgggg |
109 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |
|
|
| T |
24304360 |
tgggttaataggtttttaccccctgccatttgggg |
24304326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 79 - 129
Target Start/End: Original strand, 37182076 - 37182126
Alignment:
| Q |
79 |
ttaataggcttttaccccctgccatttgggggtcttttggtatacccccta |
129 |
Q |
| |
|
|||||||||||||||||||||| || |||| ||||||||| ||||||||| |
|
|
| T |
37182076 |
ttaataggcttttaccccctgctatatgggcgtcttttggcttacccccta |
37182126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 148 - 194
Target Start/End: Original strand, 43402327 - 43402373
Alignment:
| Q |
148 |
cttggagattccccctcgtaaaatgaagattctttggtttacacccc |
194 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
43402327 |
cttggagattcccctatgtaaaataaagattctttggtttacacccc |
43402373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 148 - 194
Target Start/End: Complemental strand, 48030223 - 48030177
Alignment:
| Q |
148 |
cttggagattccccctcgtaaaatgaagattctttggtttacacccc |
194 |
Q |
| |
|
||||||||||| |||| ||||||| ||||||||||||||||||||| |
|
|
| T |
48030223 |
cttggagattctcccttataaaatgtagattctttggtttacacccc |
48030177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 199
Target Start/End: Complemental strand, 51676322 - 51676272
Alignment:
| Q |
149 |
ttggagattccccctcgtaaaatgaagattctttggtttacacccctgatg |
199 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||||| ||| || |||||||| |
|
|
| T |
51676322 |
ttggagaatcccccttgtaaaatgaagattctttgattttcaaccctgatg |
51676272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 99 - 127
Target Start/End: Original strand, 35712472 - 35712500
Alignment:
| Q |
99 |
gccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
35712472 |
gccatttgggggtcttttggtataccccc |
35712500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 51; Significance: 2e-20; HSPs: 15)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 76 - 130
Target Start/End: Original strand, 14099745 - 14099799
Alignment:
| Q |
76 |
gggttaataggcttttaccccctgccatttgggggtcttttggtataccccctat |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
14099745 |
gggttaataggcttttaccccctgccatttgggggtcttttggtttaccccctat |
14099799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 76 - 127
Target Start/End: Original strand, 38973753 - 38973804
Alignment:
| Q |
76 |
gggttaataggcttttaccccctgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
38973753 |
gggttaataggtttttaccccctgccatttgggggttttttggtataccccc |
38973804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 76 - 127
Target Start/End: Original strand, 39004851 - 39004902
Alignment:
| Q |
76 |
gggttaataggcttttaccccctgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
39004851 |
gggttaataggtttttaccccctgccatttgggggttttttggtataccccc |
39004902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 76 - 127
Target Start/End: Original strand, 9755684 - 9755736
Alignment:
| Q |
76 |
gggttaataggcttttacccc-ctgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
9755684 |
gggttaatagacttttacccccctgccatttgggggtcttttggtataccccc |
9755736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 76 - 127
Target Start/End: Original strand, 42480898 - 42480949
Alignment:
| Q |
76 |
gggttaataggcttttaccccctgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| ||||||| ||||||| |
|
|
| T |
42480898 |
gggttaataggcttttaccccctgccatttaggggttttttggtttaccccc |
42480949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 159 - 201
Target Start/End: Complemental strand, 26521977 - 26521935
Alignment:
| Q |
159 |
cccctcgtaaaatgaagattctttggtttacacccctgatgtc |
201 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26521977 |
ccccttgtaaaatgaagattctttggtttacacccctgatgtc |
26521935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 76 - 130
Target Start/End: Complemental strand, 38980211 - 38980157
Alignment:
| Q |
76 |
gggttaataggcttttaccccctgccatttgggggtcttttggtataccccctat |
130 |
Q |
| |
|
||||||||||| |||||||||||| |||||||| |||||||||| |||||||||| |
|
|
| T |
38980211 |
gggttaataggtttttaccccctgtcatttgggagtcttttggtttaccccctat |
38980157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 76 - 130
Target Start/End: Complemental strand, 39011308 - 39011254
Alignment:
| Q |
76 |
gggttaataggcttttaccccctgccatttgggggtcttttggtataccccctat |
130 |
Q |
| |
|
||||||||||| |||||||||||| |||||||| |||||||||| |||||||||| |
|
|
| T |
39011308 |
gggttaataggtttttaccccctgtcatttgggagtcttttggtttaccccctat |
39011254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 76 - 127
Target Start/End: Original strand, 3917796 - 3917847
Alignment:
| Q |
76 |
gggttaataggcttttaccccctgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | | |||||| ||||||| |
|
|
| T |
3917796 |
gggttaataggcttttaccccctgccatttgggcgacatttggtttaccccc |
3917847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 74 - 122
Target Start/End: Complemental strand, 34315215 - 34315168
Alignment:
| Q |
74 |
atgggttaataggcttttaccccctgccatttgggggtcttttggtata |
122 |
Q |
| |
|
|||||||||||| |||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
34315215 |
atgggttaatagacttttacccc-tgctatttgggggtcttttggtata |
34315168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 148 - 194
Target Start/End: Original strand, 38973819 - 38973864
Alignment:
| Q |
148 |
cttggagattccccctcgtaaaatgaagattctttggtttacacccc |
194 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
38973819 |
cttggagattctcccg-gtaaaatgaagattctttggtttacacccc |
38973864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 148 - 194
Target Start/End: Original strand, 39004917 - 39004962
Alignment:
| Q |
148 |
cttggagattccccctcgtaaaatgaagattctttggtttacacccc |
194 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
39004917 |
cttggagattctcccg-gtaaaatgaagattctttggtttacacccc |
39004962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 76 - 129
Target Start/End: Original strand, 40462270 - 40462324
Alignment:
| Q |
76 |
gggttaataggctttta-ccccctgccatttgggggtcttttggtatacccccta |
129 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||| | |||||||| ||||||||| |
|
|
| T |
40462270 |
gggttaataggcttttacccccctgccatatgggtgacttttggtttacccccta |
40462324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 76 - 127
Target Start/End: Complemental strand, 14101143 - 14101091
Alignment:
| Q |
76 |
gggttaataggcttttac-cccctgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
|||||||||||||||||| |||||||||| || | |||||||||| ||||||| |
|
|
| T |
14101143 |
gggttaataggcttttacccccctgccatatgagcgtcttttggtttaccccc |
14101091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 93 - 125
Target Start/End: Complemental strand, 40463642 - 40463610
Alignment:
| Q |
93 |
ccccctgccatttgggggtcttttggtataccc |
125 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
40463642 |
ccccctgccatttgggggtcttttggtttaccc |
40463610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 51; Significance: 2e-20; HSPs: 36)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 77 - 127
Target Start/End: Original strand, 56083355 - 56083405
Alignment:
| Q |
77 |
ggttaataggcttttaccccctgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56083355 |
ggttaataggcttttaccccctgccatttgggggtcttttggtataccccc |
56083405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 74 - 127
Target Start/End: Original strand, 47861931 - 47861984
Alignment:
| Q |
74 |
atgggttaataggcttttaccccctgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
47861931 |
atggattaataggcttttaccccctgccatttgggggtcttttggtttaccccc |
47861984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 76 - 129
Target Start/End: Original strand, 12861412 - 12861465
Alignment:
| Q |
76 |
gggttaataggcttttaccccctgccatttgggggtcttttggtatacccccta |
129 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||||||| ||||||||| |
|
|
| T |
12861412 |
gggttaataggcttttaccccctgctatttgggggtgttttggtttacccccta |
12861465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 75 - 127
Target Start/End: Complemental strand, 23506438 - 23506385
Alignment:
| Q |
75 |
tgggttaataggcttttaccccc-tgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
23506438 |
tgggttaataggcttttacccccctgccatttgggggtcttttggtttaccccc |
23506385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 76 - 127
Target Start/End: Complemental strand, 1997112 - 1997060
Alignment:
| Q |
76 |
gggttaataggcttttaccccc-tgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
|||||||||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
1997112 |
gggttaataggcttttacccccctgccatttaggggtcttttggtataccccc |
1997060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 76 - 127
Target Start/End: Complemental strand, 16314255 - 16314203
Alignment:
| Q |
76 |
gggttaataggcttttaccccc-tgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
16314255 |
gggttaataggcttttacccccctgccatttgggggtcttttggtttaccccc |
16314203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 76 - 130
Target Start/End: Original strand, 20673565 - 20673620
Alignment:
| Q |
76 |
gggttaataggcttttacccc-ctgccatttgggggtcttttggtataccccctat |
130 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||||| |||||||||| |
|
|
| T |
20673565 |
gggttaataggcttttacccccctgccatttgggtgtcttttggtttaccccctat |
20673620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 76 - 123
Target Start/End: Complemental strand, 44355466 - 44355419
Alignment:
| Q |
76 |
gggttaataggcttttaccccctgccatttgggggtcttttggtatac |
123 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
44355466 |
gggttaataggtttttaccccctgccatttggaggtcttttggtatac |
44355419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 148 - 194
Target Start/End: Complemental strand, 1997044 - 1996998
Alignment:
| Q |
148 |
cttggagattccccctcgtaaaatgaagattctttggtttacacccc |
194 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
1997044 |
cttggagattcccccttgtaaaatgtagattctttggtttacacccc |
1996998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 75 - 127
Target Start/End: Original strand, 5169312 - 5169365
Alignment:
| Q |
75 |
tgggttaataggcttttacccc-ctgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |||||||||| ||||||| |
|
|
| T |
5169312 |
tgggttaataggcttttacccccctgccatttgggcgtcttttggtttaccccc |
5169365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 75 - 127
Target Start/End: Original strand, 17288630 - 17288683
Alignment:
| Q |
75 |
tgggttaataggcttttacccc-ctgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |||||||| ||||||| |
|
|
| T |
17288630 |
tgggttaataggcttttacccccctgccatttgggggacttttggtttaccccc |
17288683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 76 - 127
Target Start/End: Original strand, 1995868 - 1995920
Alignment:
| Q |
76 |
gggttaataggcttttacccc-ctgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
||||||||||||||| ||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
1995868 |
gggttaataggctttcacccccctgccatatgggggtcttttggtataccccc |
1995920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 76 - 127
Target Start/End: Original strand, 2751518 - 2751570
Alignment:
| Q |
76 |
gggttaataggctttta-ccccctgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
2751518 |
gggttaataagcttttatccccctgccatttgggggacttttggtataccccc |
2751570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 149 - 201
Target Start/End: Complemental strand, 12862699 - 12862647
Alignment:
| Q |
149 |
ttggagattccccctcgtaaaatgaagattctttggtttacacccctgatgtc |
201 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| ||| || |||||||||| |
|
|
| T |
12862699 |
ttggagattcccccttgtaaaatgaagattctttgattttcaaccctgatgtc |
12862647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 76 - 127
Target Start/End: Original strand, 23504895 - 23504947
Alignment:
| Q |
76 |
gggttaataggcttttacccc-ctgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| || ||||||| |
|
|
| T |
23504895 |
gggttaataggcttttacccccctgccatttgggggtctttttgtttaccccc |
23504947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 76 - 127
Target Start/End: Complemental strand, 39661371 - 39661319
Alignment:
| Q |
76 |
gggttaataggctttta-ccccctgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
39661371 |
gggttaataggtttttaaccccctgccatttgggggtcttttggtttaccccc |
39661319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 148 - 195
Target Start/End: Original strand, 1995935 - 1995982
Alignment:
| Q |
148 |
cttggagattccccctcgtaaaatgaagattctttggtttacacccct |
195 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||||||| ||||| |
|
|
| T |
1995935 |
cttggagattcccccttgtaaaatgtagattctttggtttacccccct |
1995982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 75 - 125
Target Start/End: Complemental strand, 2753120 - 2753069
Alignment:
| Q |
75 |
tgggttaataggcttttaccccc-tgccatttgggggtcttttggtataccc |
125 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| ||||||||| |||| |
|
|
| T |
2753120 |
tgggttaataggcttttacccccctgccatttgggggacttttggtagaccc |
2753069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 76 - 130
Target Start/End: Complemental strand, 43742076 - 43742021
Alignment:
| Q |
76 |
gggttaataggcttttac-cccctgccatttgggggtcttttggtataccccctat |
130 |
Q |
| |
|
|||||||||| ||||||| ||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
43742076 |
gggttaatagacttttacacccctgctatttgggggtcttttggtttaccccctat |
43742021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 75 - 127
Target Start/End: Complemental strand, 5170440 - 5170387
Alignment:
| Q |
75 |
tgggttaataggcttttaccccc-tgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
||||||||||||||||||||||| |||||||| || || ||||||||||||||| |
|
|
| T |
5170440 |
tgggttaataggcttttacccccctgccattttggagttttttggtataccccc |
5170387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 93 - 126
Target Start/End: Original strand, 47376551 - 47376584
Alignment:
| Q |
93 |
ccccctgccatttgggggtcttttggtatacccc |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
47376551 |
ccccctgccatttgggggtcttttggtatacccc |
47376584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 79 - 119
Target Start/End: Complemental strand, 6212547 - 6212507
Alignment:
| Q |
79 |
ttaataggcttttaccccctgccatttgggggtcttttggt |
119 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
6212547 |
ttaataggtttttaccccctgtcatttgggggtcttttggt |
6212507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 76 - 119
Target Start/End: Complemental strand, 17288810 - 17288766
Alignment:
| Q |
76 |
gggttaataggcttttaccccc-tgccatttgggggtcttttggt |
119 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
17288810 |
gggttaataggcttttacccccctgccatttgggggacttttggt |
17288766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 76 - 127
Target Start/End: Original strand, 24685024 - 24685076
Alignment:
| Q |
76 |
gggttaataggcttttacccc-ctgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||| || ||||||||||||||| |
|
|
| T |
24685024 |
gggttaataggcttttacccccctgccatatgggcgtattttggtataccccc |
24685076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 76 - 127
Target Start/End: Original strand, 44353876 - 44353928
Alignment:
| Q |
76 |
gggttaataggcttttacccc-ctgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
||||||| || |||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
44353876 |
gggttaacagacttttacccccctgccatttgggggacttttggtataccccc |
44353928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 148 - 187
Target Start/End: Original strand, 5169380 - 5169419
Alignment:
| Q |
148 |
cttggagattccccctcgtaaaatgaagattctttggttt |
187 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
5169380 |
cttggagattcccccttgcaaaatgaagattctttggttt |
5169419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 151 - 194
Target Start/End: Complemental strand, 5170368 - 5170326
Alignment:
| Q |
151 |
ggagattccccctcgtaaaatgaagattctttggtttacacccc |
194 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
5170368 |
ggagattccccct-gtaaaatgaagattctttggtttacgcccc |
5170326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 148 - 195
Target Start/End: Complemental strand, 16314188 - 16314141
Alignment:
| Q |
148 |
cttggagattccccctcgtaaaatgaagattctttggtttacacccct |
195 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||| || ||||| |
|
|
| T |
16314188 |
cttggagattcccccttgtaaaataaagattctttggttcacccccct |
16314141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 148 - 183
Target Start/End: Original strand, 56083421 - 56083456
Alignment:
| Q |
148 |
cttggagattccccctcgtaaaatgaagattctttg |
183 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
56083421 |
cttggagattcccccttgtaaaatgaagattctttg |
56083456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 148 - 201
Target Start/End: Complemental strand, 6658742 - 6658689
Alignment:
| Q |
148 |
cttggagattccccctcgtaaaatgaagattctttggtttacacccctgatgtc |
201 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||| ||| || ||| |||||| |
|
|
| T |
6658742 |
cttggagattcccctttgtaaaatgaagattctttgattttcaacccggatgtc |
6658689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 76 - 129
Target Start/End: Complemental strand, 6658807 - 6658754
Alignment:
| Q |
76 |
gggttaataggcttttaccccctgccatttgggggtcttttggtatacccccta |
129 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||| ||||||| ||||||||| |
|
|
| T |
6658807 |
gggttaatagatgtttaccccctgccatttgagggtattttggtttacccccta |
6658754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 76 - 108
Target Start/End: Complemental strand, 11429472 - 11429440
Alignment:
| Q |
76 |
gggttaataggcttttaccccctgccatttggg |
108 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
11429472 |
gggttaatagacttttaccccctgccatttggg |
11429440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 76 - 127
Target Start/End: Complemental strand, 12862768 - 12862716
Alignment:
| Q |
76 |
gggttaataggcttttaccccc-tgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||| |||| ||||||| ||||||| |
|
|
| T |
12862768 |
gggttaataggcgtttacccccctgccatttgagggtattttggtttaccccc |
12862716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 76 - 127
Target Start/End: Original strand, 16312647 - 16312699
Alignment:
| Q |
76 |
gggttaataggcttttacccc-ctgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
|||||||||| || ||||||| ||||||||||||||| ||||||| ||||||| |
|
|
| T |
16312647 |
gggttaatagcctcttacccccctgccatttgggggttttttggtttaccccc |
16312699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 76 - 128
Target Start/End: Complemental strand, 24127638 - 24127586
Alignment:
| Q |
76 |
gggttaataggcttttaccccctgccatttgggggtcttttggtataccccct |
128 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||| ||||||| |||||||| |
|
|
| T |
24127638 |
gggttaataagcttttaccccctgccatttaagggatttttggtttaccccct |
24127586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 90 - 130
Target Start/End: Original strand, 39660385 - 39660424
Alignment:
| Q |
90 |
ttaccccctgccatttgggggtcttttggtataccccctat |
130 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
39660385 |
ttaccccctgccattt-ggggtcttttggtttaccccctat |
39660424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 47; Significance: 5e-18; HSPs: 24)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 74 - 127
Target Start/End: Complemental strand, 5769362 - 5769308
Alignment:
| Q |
74 |
atgggttaataggcttttaccccc-tgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5769362 |
atgggttaataggcttttacccccctgccatttgggggtcttttggtataccccc |
5769308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 76 - 128
Target Start/End: Original strand, 6591269 - 6591321
Alignment:
| Q |
76 |
gggttaataggcttttaccccctgccatttgggggtcttttggtataccccct |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| ||||||||||| |||| |
|
|
| T |
6591269 |
gggttaataggcttttaccccctgccatttggtggtattttggtatactccct |
6591321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 76 - 127
Target Start/End: Original strand, 21261980 - 21262032
Alignment:
| Q |
76 |
gggttaataggcttttacccc-ctgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
21261980 |
gggttaataggcttttacccccctgccatttaggggtcttttggtataccccc |
21262032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 76 - 127
Target Start/End: Complemental strand, 19628235 - 19628184
Alignment:
| Q |
76 |
gggttaataggcttttaccccctgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
19628235 |
gggttaataggtttttaccccctgccatttgggagtcttttggtttaccccc |
19628184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 148 - 194
Target Start/End: Original strand, 21262048 - 21262094
Alignment:
| Q |
148 |
cttggagattccccctcgtaaaatgaagattctttggtttacacccc |
194 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
21262048 |
cttggagattcccccttgtaaaatgtagattctttggtttacacccc |
21262094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 148 - 201
Target Start/End: Complemental strand, 7849244 - 7849192
Alignment:
| Q |
148 |
cttggagattccccctcgtaaaatgaagattctttggtttacacccctgatgtc |
201 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
7849244 |
cttggagattcccctt-gtaaaatgaagattctttggtttacatccctgatgtc |
7849192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 75 - 127
Target Start/End: Complemental strand, 47578640 - 47578587
Alignment:
| Q |
75 |
tgggttaataggcttttaccccc-tgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| | |||||||||||||||| |
|
|
| T |
47578640 |
tgggttaataggcttttacccccctgccatttgggagacttttggtataccccc |
47578587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 76 - 127
Target Start/End: Original strand, 5737177 - 5737229
Alignment:
| Q |
76 |
gggttaataggcttttacccc-ctgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
5737177 |
gggttaataggcttttacccccctgccatttgggggctttttggtataccccc |
5737229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 76 - 127
Target Start/End: Original strand, 12628033 - 12628085
Alignment:
| Q |
76 |
gggttaataggcttttacccc-ctgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||||||||||| ||||||| |
|
|
| T |
12628033 |
gggttaataggcttttacccccctgccatttgcgggtcttttggtttaccccc |
12628085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 76 - 127
Target Start/End: Complemental strand, 21263373 - 21263321
Alignment:
| Q |
76 |
gggttaataggcttttaccccc-tgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
||||||||||||||| |||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
21263373 |
gggttaataggctttcacccccctgccatatgggggtcttttggtataccccc |
21263321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 76 - 127
Target Start/End: Original strand, 23525581 - 23525633
Alignment:
| Q |
76 |
gggttaataggcttttacccc-ctgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
23525581 |
gggttaataggcttttaccccgctgccatttgggggatttttggtataccccc |
23525633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 76 - 130
Target Start/End: Original strand, 7848006 - 7848061
Alignment:
| Q |
76 |
gggttaataggcttttacccc-ctgccatttgggggtcttttggtataccccctat |
130 |
Q |
| |
|
|||||||| |||||||||||| ||||||| || ||||||||||||||||||||||| |
|
|
| T |
7848006 |
gggttaatgggcttttacccccctgccatatgagggtcttttggtataccccctat |
7848061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 148 - 195
Target Start/End: Complemental strand, 21263306 - 21263259
Alignment:
| Q |
148 |
cttggagattccccctcgtaaaatgaagattctttggtttacacccct |
195 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||||||| ||||| |
|
|
| T |
21263306 |
cttggagattcccccttgtaaaatgtagattctttggtttacccccct |
21263259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 148 - 199
Target Start/End: Complemental strand, 23526754 - 23526703
Alignment:
| Q |
148 |
cttggagattccccctcgtaaaatgaagattctttggtttacacccctgatg |
199 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
23526754 |
cttggagattcccccctataaaatgaagattctttggtttacacccatgatg |
23526703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 88 - 130
Target Start/End: Original strand, 15814446 - 15814488
Alignment:
| Q |
88 |
ttttaccccctgccatttgggggtcttttggtataccccctat |
130 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
15814446 |
ttttaccccctgccatatgggcgtcttttggtataccccctat |
15814488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 76 - 127
Target Start/End: Complemental strand, 12629483 - 12629431
Alignment:
| Q |
76 |
gggttaataggcttttaccccc-tgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |||||||||||| ||||||| |
|
|
| T |
12629483 |
gggttaataggcttttacccccctgccatttacgggtcttttggtttaccccc |
12629431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 165 - 195
Target Start/End: Original strand, 23525672 - 23525702
Alignment:
| Q |
165 |
gtaaaatgaagattctttggtttacacccct |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
23525672 |
gtaaaatgaagattctttggtttacacccct |
23525702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 76 - 129
Target Start/End: Original strand, 91938 - 91991
Alignment:
| Q |
76 |
gggttaataggcttttaccccctgccatttgggggtcttttggtatacccccta |
129 |
Q |
| |
|
||||||| ||||||||||||||| ||| |||| |||||||||| ||||||||| |
|
|
| T |
91938 |
gggttaactggcttttaccccctgtcatatgggcgtcttttggtttacccccta |
91991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 152 - 197
Target Start/End: Original strand, 7848075 - 7848120
Alignment:
| Q |
152 |
gagattccccctcgtaaaatgaagattctttggtttacacccctga |
197 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||| | |||||||||| |
|
|
| T |
7848075 |
gagattcccccttgtaaaatgaagattctctggctaacacccctga |
7848120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 148 - 189
Target Start/End: Complemental strand, 19628167 - 19628126
Alignment:
| Q |
148 |
cttggagattccccctcgtaaaatgaagattctttggtttac |
189 |
Q |
| |
|
|||||||||||||||| ||||||| |||||| |||||||||| |
|
|
| T |
19628167 |
cttggagattcccccttgtaaaataaagattatttggtttac |
19628126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 76 - 128
Target Start/End: Complemental strand, 23456733 - 23456680
Alignment:
| Q |
76 |
gggttaataggcttttac-cccctgccatttgggggtcttttggtataccccct |
128 |
Q |
| |
|
||||||||||| |||||| |||||||||| || | ||||||||||||||||||| |
|
|
| T |
23456733 |
gggttaataggtttttactcccctgccatatgagcgtcttttggtataccccct |
23456680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 148 - 197
Target Start/End: Original strand, 47573157 - 47573206
Alignment:
| Q |
148 |
cttggagattccccctcgtaaaatgaagattctttggtttacacccctga |
197 |
Q |
| |
|
||||||||||| ||| |||||||||||||| |||||||| ||||||||| |
|
|
| T |
47573157 |
cttggagattcttccttgtaaaatgaagattttttggtttgcacccctga |
47573206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 75 - 103
Target Start/End: Complemental strand, 41097790 - 41097762
Alignment:
| Q |
75 |
tgggttaataggcttttaccccctgccat |
103 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
41097790 |
tgggttaataggcttttaccccctgccat |
41097762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 148 - 184
Target Start/End: Complemental strand, 47578569 - 47578533
Alignment:
| Q |
148 |
cttggagattccccctcgtaaaatgaagattctttgg |
184 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
47578569 |
cttggagattcccccttttaaaatgaagattctttgg |
47578533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 46; Significance: 2e-17; HSPs: 8)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 148 - 197
Target Start/End: Original strand, 27490168 - 27490217
Alignment:
| Q |
148 |
cttggagattccccctcgtaaaatgaagattctttggtttacacccctga |
197 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
27490168 |
cttggagattcccccttgtaaaatgaagattctttggtttacacccctga |
27490217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 76 - 127
Target Start/End: Original strand, 12316348 - 12316399
Alignment:
| Q |
76 |
gggttaataggcttttaccccctgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
12316348 |
gggttaataggcttttactccctgccatttggaggtcttttggtataccccc |
12316399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 148 - 199
Target Start/End: Complemental strand, 27491262 - 27491211
Alignment:
| Q |
148 |
cttggagattccccctcgtaaaatgaagattctttggtttacacccctgatg |
199 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
27491262 |
cttggagattccccattgtaaaatgaagattctttggtttacacccctgatg |
27491211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 76 - 126
Target Start/End: Complemental strand, 27491328 - 27491278
Alignment:
| Q |
76 |
gggttaataggcttttaccccctgccatttgggggtcttttggtatacccc |
126 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
27491328 |
gggttaataggcttttaccccctgcaatttgggggacttttggtacacccc |
27491278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 76 - 128
Target Start/End: Original strand, 27490099 - 27490152
Alignment:
| Q |
76 |
gggttaataggcttttacc-ccctgccatttgggggtcttttggtataccccct |
128 |
Q |
| |
|
||||||||||||||||||| ||||| ||| |||||||||||||||||||||||| |
|
|
| T |
27490099 |
gggttaataggcttttacctccctgtcatatgggggtcttttggtataccccct |
27490152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 76 - 127
Target Start/End: Original strand, 29875947 - 29875998
Alignment:
| Q |
76 |
gggttaataggcttttaccccctgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | | |||||| ||||||| |
|
|
| T |
29875947 |
gggttaataggcttttaccccctgccatttgggcgacatttggtttaccccc |
29875998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 75 - 129
Target Start/End: Complemental strand, 6377083 - 6377029
Alignment:
| Q |
75 |
tgggttaataggcttttaccccctgccatttgggggtcttttggtatacccccta |
129 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||| ||| ||||||| ||||||||| |
|
|
| T |
6377083 |
tgggttaatagacttttaccccctgtcatttggaggtattttggtttacccccta |
6377029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 76 - 119
Target Start/End: Original strand, 7491812 - 7491855
Alignment:
| Q |
76 |
gggttaataggcttttaccccctgccatttgggggtcttttggt |
119 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
7491812 |
gggttaatagacttttaccccctgccatttgaaggtcttttggt |
7491855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 44; Significance: 3e-16; HSPs: 20)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 76 - 127
Target Start/End: Original strand, 12603937 - 12603988
Alignment:
| Q |
76 |
gggttaataggcttttaccccctgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
12603937 |
gggttaataggcttttaccccctgccatttgggagtcttttggtttaccccc |
12603988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 78 - 127
Target Start/End: Complemental strand, 26545920 - 26545871
Alignment:
| Q |
78 |
gttaataggcttttaccccctgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
26545920 |
gttaataggcttttaccccctgccatttgagggtcttttggtttaccccc |
26545871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 76 - 127
Target Start/End: Complemental strand, 21383874 - 21383822
Alignment:
| Q |
76 |
gggttaataggcttttaccccc-tgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
|||||||||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
21383874 |
gggttaataggcttttacccccctgccatttaggggtcttttggtataccccc |
21383822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 76 - 127
Target Start/End: Complemental strand, 32146146 - 32146094
Alignment:
| Q |
76 |
gggttaataggctttta-ccccctgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
32146146 |
gggttaataggcttttatccccctgccatttgggggtcttttggtttaccccc |
32146094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 76 - 127
Target Start/End: Complemental strand, 25483453 - 25483402
Alignment:
| Q |
76 |
gggttaataggcttttaccccctgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
25483453 |
gggttaataggcttttaccccctgccatttgggagtcttttggattaccccc |
25483402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 148 - 194
Target Start/End: Complemental strand, 21383807 - 21383761
Alignment:
| Q |
148 |
cttggagattccccctcgtaaaatgaagattctttggtttacacccc |
194 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
21383807 |
cttggagattcccccttgtaaaatgtagattctttggtttacacccc |
21383761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 149 - 195
Target Start/End: Complemental strand, 26545853 - 26545807
Alignment:
| Q |
149 |
ttggagattccccctcgtaaaatgaagattctttggtttacacccct |
195 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
26545853 |
ttggagattcccccttgtaaaataaagattctttggtttacacccct |
26545807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 76 - 128
Target Start/End: Original strand, 6624253 - 6624304
Alignment:
| Q |
76 |
gggttaataggcttttaccccctgccatttgggggtcttttggtataccccct |
128 |
Q |
| |
|
||||||||||| ||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
6624253 |
gggttaataggtttttaccccttgccattt-ggggtcttttggtataccccct |
6624304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 76 - 127
Target Start/End: Original strand, 21382482 - 21382534
Alignment:
| Q |
76 |
gggttaataggcttttacccc-ctgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
||||||||||||||| ||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
21382482 |
gggttaataggctttcacccccctgccatatgggggtcttttggtataccccc |
21382534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 148 - 195
Target Start/End: Original strand, 21382549 - 21382596
Alignment:
| Q |
148 |
cttggagattccccctcgtaaaatgaagattctttggtttacacccct |
195 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||||||| ||||| |
|
|
| T |
21382549 |
cttggagattcccccttgtaaaatgtagattctttggtttacccccct |
21382596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 149 - 183
Target Start/End: Original strand, 7538329 - 7538363
Alignment:
| Q |
149 |
ttggagattccccctcgtaaaatgaagattctttg |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
7538329 |
ttggagattccccctcgtaaaatgaagattctttg |
7538363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 149 - 194
Target Start/End: Original strand, 32145123 - 32145167
Alignment:
| Q |
149 |
ttggagattccccctcgtaaaatgaagattctttggtttacacccc |
194 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
32145123 |
ttggagattccccct-gtaaaataaagattctttggtttacacccc |
32145167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 76 - 128
Target Start/End: Original strand, 21511492 - 21511544
Alignment:
| Q |
76 |
gggttaataggcttttaccccctgccatttgggggtcttttggtataccccct |
128 |
Q |
| |
|
||||||||| | |||||||||| ||||||||||| ||||||||| |||||||| |
|
|
| T |
21511492 |
gggttaataaggttttacccccggccatttggggatcttttggtttaccccct |
21511544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 76 - 127
Target Start/End: Original strand, 25482148 - 25482200
Alignment:
| Q |
76 |
gggttaataggcttttacccc-ctgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
||||||||||||||||||||| ||||||||| || |||||||||| ||||||| |
|
|
| T |
25482148 |
gggttaataggcttttacccccctgccatttaggagtcttttggtttaccccc |
25482200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 76 - 130
Target Start/End: Complemental strand, 9307194 - 9307139
Alignment:
| Q |
76 |
gggttaataggcttttaccccc-tgccatttgggggtcttttggtataccccctat |
130 |
Q |
| |
|
||||||||||| |||||||||| |||||| |||| || |||||||||||||||||| |
|
|
| T |
9307194 |
gggttaataggtttttacccccctgccatatgggcgtattttggtataccccctat |
9307139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 75 - 130
Target Start/End: Complemental strand, 12605299 - 12605244
Alignment:
| Q |
75 |
tgggttaataggcttttaccccctgccatttgggggtcttttggtataccccctat |
130 |
Q |
| |
|
||||||||||| |||||| |||||||||||| | |||||||||| |||||||||| |
|
|
| T |
12605299 |
tgggttaatagacttttatcccctgccatttatgagtcttttggtttaccccctat |
12605244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 148 - 187
Target Start/End: Original strand, 26544411 - 26544450
Alignment:
| Q |
148 |
cttggagattccccctcgtaaaatgaagattctttggttt |
187 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
26544411 |
cttggagattcccccttgtaaaataaagattctttggttt |
26544450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 76 - 125
Target Start/End: Original strand, 5858898 - 5858948
Alignment:
| Q |
76 |
gggttaataggcttttacccc-ctgccatttgggggtcttttggtataccc |
125 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||| ||||||| ||||| |
|
|
| T |
5858898 |
gggttaatagacttttacccccctgccatttgggggttttttggtttaccc |
5858948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 148 - 198
Target Start/End: Original strand, 6624325 - 6624374
Alignment:
| Q |
148 |
cttggagattccccctcgtaaaatgaagattctttggtttacacccctgat |
198 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||||||| || ||||||| |
|
|
| T |
6624325 |
cttggagattccccct-gtaaaataaagattctttggtttccaaccctgat |
6624374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 76 - 127
Target Start/End: Original strand, 35223132 - 35223184
Alignment:
| Q |
76 |
gggttaataggcttttacccc-ctgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| ||| ||||||| ||||||| |
|
|
| T |
35223132 |
gggttaatagacttttacccccctgccatttggcggtgttttggtttaccccc |
35223184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0484 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 2)
Name: scaffold0484
Description:
Target: scaffold0484; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 76 - 130
Target Start/End: Original strand, 11536 - 11590
Alignment:
| Q |
76 |
gggttaataggcttttaccccctgccatttgggggtcttttggtataccccctat |
130 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
11536 |
gggttaataggcttttaccccctgccatttgggagtcttttggattaccccctat |
11590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0484; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 76 - 130
Target Start/End: Complemental strand, 12851 - 12797
Alignment:
| Q |
76 |
gggttaataggcttttaccccctgccatttgggggtcttttggtataccccctat |
130 |
Q |
| |
|
|||||||||||||||||||| | ||||||| || |||||||||| |||||||||| |
|
|
| T |
12851 |
gggttaataggcttttaccctccgccatttaggagtcttttggtttaccccctat |
12797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 34)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 76 - 130
Target Start/End: Original strand, 48537852 - 48537905
Alignment:
| Q |
76 |
gggttaataggcttttaccccctgccatttgggggtcttttggtataccccctat |
130 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
48537852 |
gggttaataggcttttacccc-tgccatttgggggtcttttggtttaccccctat |
48537905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 76 - 127
Target Start/End: Complemental strand, 36438827 - 36438775
Alignment:
| Q |
76 |
gggttaataggcttttaccccc-tgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
36438827 |
gggttaataggcttttacccccctgccatttgggggtcttttggtttaccccc |
36438775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 77 - 128
Target Start/End: Original strand, 42277232 - 42277283
Alignment:
| Q |
77 |
ggttaataggcttttaccccctgccatttgggggtcttttggtataccccct |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
42277232 |
ggttaataggcttttaccccctgccatttgggttttttttggtataccccct |
42277283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 76 - 126
Target Start/End: Complemental strand, 13866007 - 13865958
Alignment:
| Q |
76 |
gggttaataggcttttaccccctgccatttgggggtcttttggtatacccc |
126 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
13866007 |
gggttaataggcttttacccc-taccatttgggggtcttttggtatacccc |
13865958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 148 - 194
Target Start/End: Original strand, 39605646 - 39605692
Alignment:
| Q |
148 |
cttggagattccccctcgtaaaatgaagattctttggtttacacccc |
194 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
39605646 |
cttggagattcccccctgtaaaatgaagattctttggtttacacccc |
39605692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 76 - 127
Target Start/End: Original strand, 15438470 - 15438522
Alignment:
| Q |
76 |
gggttaataggcttttacccc-ctgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||| ||||||||||||||| |
|
|
| T |
15438470 |
gggttaataggcttttacccccctgccatttgagggttttttggtataccccc |
15438522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 76 - 127
Target Start/End: Complemental strand, 15439733 - 15439681
Alignment:
| Q |
76 |
gggttaataggcttttaccccct-gccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
15439733 |
gggttaataggcttttacccccccgccatttgggggtcttttggtttaccccc |
15439681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 76 - 127
Target Start/End: Original strand, 34799865 - 34799917
Alignment:
| Q |
76 |
gggttaataggcttttacccc-ctgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
34799865 |
gggttaatagacttttacccccctgccatttgggggtcttttggtttaccccc |
34799917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 76 - 127
Target Start/End: Complemental strand, 42278509 - 42278457
Alignment:
| Q |
76 |
gggttaataggcttttaccccc-tgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||||||||||| ||||||| |
|
|
| T |
42278509 |
gggttaataggcttttacccccctaccatttgggggtcttttggtttaccccc |
42278457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 148 - 195
Target Start/End: Original strand, 34799932 - 34799979
Alignment:
| Q |
148 |
cttggagattccccctcgtaaaatgaagattctttggtttacacccct |
195 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||| ||||| |
|
|
| T |
34799932 |
cttggagattcccccttgcaaaatgaagattctttggtttacccccct |
34799979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 148 - 195
Target Start/End: Complemental strand, 34801378 - 34801331
Alignment:
| Q |
148 |
cttggagattccccctcgtaaaatgaagattctttggtttacacccct |
195 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||||||||| ||||| |
|
|
| T |
34801378 |
cttggagattcccccttgtaaaataaagattctttggtttacccccct |
34801331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 79 - 130
Target Start/End: Original strand, 46651699 - 46651749
Alignment:
| Q |
79 |
ttaataggcttttaccccctgccatttgggggtcttttggtataccccctat |
130 |
Q |
| |
|
||||| ||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
46651699 |
ttaatgggcttttaccccctgccatatgggg-tcttttggtataccccctat |
46651749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 159 - 201
Target Start/End: Original strand, 34825663 - 34825705
Alignment:
| Q |
159 |
cccctcgtaaaatgaagattctttggtttacacccctgatgtc |
201 |
Q |
| |
|
||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
34825663 |
ccccttgtaaaatgaaaattctttggtttacacccctgatgtc |
34825705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 76 - 128
Target Start/End: Complemental strand, 9239185 - 9239132
Alignment:
| Q |
76 |
gggttaataggcttttaccc-cctgccatttgggggtcttttggtataccccct |
128 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||| ||||||| ||||||||| |
|
|
| T |
9239185 |
gggttaatagacttttaccctcctgccatttgggggacttttgggataccccct |
9239132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 74 - 127
Target Start/End: Original strand, 25338910 - 25338963
Alignment:
| Q |
74 |
atgggttaataggcttttaccccctgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||| ||| ||||||| ||||||| |
|
|
| T |
25338910 |
atgggttaatagacttttaccctctgccatttggtggttttttggtttaccccc |
25338963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 77 - 126
Target Start/End: Original strand, 39605584 - 39605632
Alignment:
| Q |
77 |
ggttaataggcttttaccccctgccatttgggggtcttttggtatacccc |
126 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||| |||||| |
|
|
| T |
39605584 |
ggttaataggcttttacccc-tgccatttgggggttttttggtgtacccc |
39605632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 76 - 127
Target Start/End: Original strand, 36437214 - 36437266
Alignment:
| Q |
76 |
gggttaataggcttttacccc-ctgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||| ||||||| ||||||| |
|
|
| T |
36437214 |
gggttaatagccttttacccccctgccatttgggggttttttggtttaccccc |
36437266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 76 - 127
Target Start/End: Original strand, 37085413 - 37085465
Alignment:
| Q |
76 |
gggttaataggctttta-ccccctgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||| |||||||||| ||||||| |
|
|
| T |
37085413 |
gggttaataggtttttatccccctgccatttgggcgtcttttggtttaccccc |
37085465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 76 - 127
Target Start/End: Complemental strand, 37086795 - 37086743
Alignment:
| Q |
76 |
gggttaataggcttttaccccc-tgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| | |||||||||| ||||||| |
|
|
| T |
37086795 |
gggttaataggcttttacccccctgccatttgagcgtcttttggtttaccccc |
37086743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 149 - 192
Target Start/End: Complemental strand, 9239119 - 9239077
Alignment:
| Q |
149 |
ttggagattccccctcgtaaaatgaagattctttggtttacacc |
192 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
9239119 |
ttggagattccccct-gtaaaatgaagattatttggtttacacc |
9239077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 148 - 195
Target Start/End: Original strand, 37085479 - 37085526
Alignment:
| Q |
148 |
cttggagattccccctcgtaaaatgaagattctttggtttacacccct |
195 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||||||| ||||| |
|
|
| T |
37085479 |
cttggagattcccccctgtaaaataaagattctttggtttacccccct |
37085526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 148 - 195
Target Start/End: Complemental strand, 37086728 - 37086681
Alignment:
| Q |
148 |
cttggagattccccctcgtaaaatgaagattctttggtttacacccct |
195 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||||||| ||||| |
|
|
| T |
37086728 |
cttggagattcccccctgtaaaataaagattctttggtttacccccct |
37086681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 148 - 187
Target Start/End: Complemental strand, 39606623 - 39606584
Alignment:
| Q |
148 |
cttggagattccccctcgtaaaatgaagattctttggttt |
187 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
39606623 |
cttggagattcccccttgcaaaatgaagattctttggttt |
39606584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 76 - 127
Target Start/End: Original strand, 48165506 - 48165557
Alignment:
| Q |
76 |
gggttaataggcttttaccccctgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
|||||||||| ||||||| |||||||||||| ||||||||||| ||||||| |
|
|
| T |
48165506 |
gggttaatagacttttacttcctgccatttggaggtcttttggtttaccccc |
48165557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 76 - 119
Target Start/End: Original strand, 52042115 - 52042158
Alignment:
| Q |
76 |
gggttaataggcttttaccccctgccatttgggggtcttttggt |
119 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||| |||||||||| |
|
|
| T |
52042115 |
gggttaataggcttttaccccctgtcatatgggtgtcttttggt |
52042158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 77 - 126
Target Start/End: Complemental strand, 11151646 - 11151596
Alignment:
| Q |
77 |
ggttaataggcttttaccccc-tgccatttgggggtcttttggtatacccc |
126 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||| |||||||| |||||| |
|
|
| T |
11151646 |
ggttaataggcttttacccccctaccatttgggggacttttggtttacccc |
11151596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 148 - 198
Target Start/End: Complemental strand, 13865943 - 13865894
Alignment:
| Q |
148 |
cttggagattccccctcgtaaaatgaagattctttggtttacacccctgat |
198 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| || ||||||| |
|
|
| T |
13865943 |
cttggagattcccccta-taaaatgaagattctttggttttcaaccctgat |
13865894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 93 - 127
Target Start/End: Complemental strand, 34801427 - 34801393
Alignment:
| Q |
93 |
ccccctgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |
|
|
| T |
34801427 |
ccccctgccatttgggggtcttttggtttaccccc |
34801393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 148 - 194
Target Start/End: Complemental strand, 52092885 - 52092839
Alignment:
| Q |
148 |
cttggagattccccctcgtaaaatgaagattctttggtttacacccc |
194 |
Q |
| |
|
|||||||||||| ||| ||||||| ||||||||||| |||||||||| |
|
|
| T |
52092885 |
cttggagattcctccttgtaaaataaagattctttgatttacacccc |
52092839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 77 - 130
Target Start/End: Original strand, 14997027 - 14997079
Alignment:
| Q |
77 |
ggttaataggcttttaccccctgccatttgggggtcttttggtataccccctat |
130 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||||| || ||||||| |
|
|
| T |
14997027 |
ggttaataggcttttacccc-tgccatttggaagtcttttggtttatcccctat |
14997079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 74 - 103
Target Start/End: Original strand, 23903272 - 23903301
Alignment:
| Q |
74 |
atgggttaataggcttttaccccctgccat |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
23903272 |
atgggttaataggcttttaccccctgccat |
23903301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 76 - 127
Target Start/End: Original strand, 11150271 - 11150323
Alignment:
| Q |
76 |
gggttaataggctttta-ccccctgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||| ||||||| ||||||| |
|
|
| T |
11150271 |
gggttaataggcttttaccccccagccatttgggggatttttggtttaccccc |
11150323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 75 - 103
Target Start/End: Complemental strand, 11494641 - 11494613
Alignment:
| Q |
75 |
tgggttaataggcttttaccccctgccat |
103 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
11494641 |
tgggttaataggcttttaccccctgccat |
11494613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 75 - 127
Target Start/End: Original strand, 13865043 - 13865095
Alignment:
| Q |
75 |
tgggttaataggcttttaccccctgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
|||||||||||| ||||| |||||| ||||||| ||| |||||||||| |||| |
|
|
| T |
13865043 |
tgggttaataggtttttatcccctgtcatttggtggtattttggtatatcccc |
13865095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0049 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 2)
Name: scaffold0049
Description:
Target: scaffold0049; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 76 - 128
Target Start/End: Complemental strand, 3976 - 3924
Alignment:
| Q |
76 |
gggttaataggcttttaccccctgccatttgggggtcttttggtataccccct |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| || ||||| |
|
|
| T |
3976 |
gggttaataggcttttaccccctgccatttgggggacttttggtttatcccct |
3924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0049; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 75 - 124
Target Start/End: Original strand, 385 - 435
Alignment:
| Q |
75 |
tgggttaataggcttttacccc-ctgccatttgggggtcttttggtatacc |
124 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |||||||| |||| |
|
|
| T |
385 |
tgggttaataggcttttacccccctgccatttgggggacttttggtttacc |
435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0262 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: scaffold0262
Description:
Target: scaffold0262; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 76 - 130
Target Start/End: Complemental strand, 4434 - 4379
Alignment:
| Q |
76 |
gggttaataggcttttaccccct-gccatttgggggtcttttggtataccccctat |
130 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
4434 |
gggttaataggcttttatccccttgccatttgggggtcttttggtttaccccctat |
4379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0408 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold0408
Description:
Target: scaffold0408; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 76 - 126
Target Start/End: Original strand, 10087 - 10136
Alignment:
| Q |
76 |
gggttaataggcttttaccccctgccatttgggggtcttttggtatacccc |
126 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
10087 |
gggttaataggcttttacccc-tgccatttgggggtcttttggtttacccc |
10136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0071 (Bit Score: 37; Significance: 0.000000000005; HSPs: 2)
Name: scaffold0071
Description:
Target: scaffold0071; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 76 - 127
Target Start/End: Original strand, 22458 - 22510
Alignment:
| Q |
76 |
gggttaataggcttttaccccct-gccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
22458 |
gggttaataggcttttacccccccgccatttgggggtcttttggtttaccccc |
22510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0071; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 76 - 127
Target Start/End: Complemental strand, 23721 - 23669
Alignment:
| Q |
76 |
gggttaataggcttttaccccc-tgccatttgggggtcttttggtataccccc |
127 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |||| ||||||||||||||| |
|
|
| T |
23721 |
gggttaataggcttttacccccctgccatttgagggttttttggtataccccc |
23669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0197 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0197
Description:
Target: scaffold0197; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 76 - 117
Target Start/End: Original strand, 28783 - 28824
Alignment:
| Q |
76 |
gggttaataggcttttaccccctgccatttgggggtcttttg |
117 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
28783 |
gggttaattggcttttaccccctgccatttgggggttttttg |
28824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0471 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0471
Description:
Target: scaffold0471; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 76 - 128
Target Start/End: Complemental strand, 12244 - 12192
Alignment:
| Q |
76 |
gggttaataggcttttaccccctgccatttgggggtcttttggtataccccct |
128 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||| ||||||| |||||||| |
|
|
| T |
12244 |
gggttaataagcttttaccccctgccatttaagggatttttggtttaccccct |
12192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0061 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0061
Description:
Target: scaffold0061; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 76 - 119
Target Start/End: Complemental strand, 11308 - 11264
Alignment:
| Q |
76 |
gggttaataggcttttaccccc-tgccatttgggggtcttttggt |
119 |
Q |
| |
|
||||||||||| |||||||||| |||||| ||||||||||||||| |
|
|
| T |
11308 |
gggttaataggtttttacccccctgccatatgggggtcttttggt |
11264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University