View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8180A_low_344 (Length: 214)
Name: NF8180A_low_344
Description: NF8180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8180A_low_344 |
 |  |
|
| [»] scaffold0191 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 41 - 196
Target Start/End: Original strand, 929746 - 929901
Alignment:
| Q |
41 |
aaccattttaatatgcgacactatgccgcttacattcattgagtttccttcaaagataatttgatttctacctagcaaaatgcattagattgtatccatc |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
929746 |
aaccattttaatatgcgacactatgccgcttacattcattgagtttccttcaaagataatttgatttctacctagaaaaatgcattagattgtatccatc |
929845 |
T |
 |
| Q |
141 |
catacacgataaatgtgagaatttcctacctttcttcccacctttgataccacaat |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
929846 |
catacacgataaatgtgagaatttcctacctttcttaccacctttgataccacaat |
929901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0191 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0191
Description:
Target: scaffold0191; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 150 - 194
Target Start/End: Complemental strand, 24981 - 24937
Alignment:
| Q |
150 |
taaatgtgagaatttcctacctttcttcccacctttgataccaca |
194 |
Q |
| |
|
|||||||||| |||||||| ||||||| ||||||||||||||||| |
|
|
| T |
24981 |
taaatgtgagcatttcctatctttcttaccacctttgataccaca |
24937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University