View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8180A_low_346 (Length: 213)
Name: NF8180A_low_346
Description: NF8180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8180A_low_346 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 17 - 198
Target Start/End: Original strand, 28921996 - 28922177
Alignment:
| Q |
17 |
caatgatggattttagagataatttgtcaacaacaataaggaacaaaaaatgaaaatgagagatagatagagatgagagcaatgtagaagattaaatcag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
28921996 |
caatgatggattttagagataatttgtcaacaacaataaggaacaaaaaatgaaaaagagagatagatagagatgggagcaatgtagaagattaaatcag |
28922095 |
T |
|
| Q |
117 |
tccttcctttctactaatgccttgattaaatcttgaagtagttatgaccatcgaatactccttggtaacacgtgagtataat |
198 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||| || || |||||||||||||||||||||| |||| |
|
|
| T |
28922096 |
tccttcctttctattaatgccttgattaaatcttgaagtagttatgactatggagtactccttggtaacacgtgagtttaat |
28922177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University