View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8180A_low_347 (Length: 213)
Name: NF8180A_low_347
Description: NF8180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8180A_low_347 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 61; Significance: 2e-26; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 47 - 119
Target Start/End: Original strand, 2230876 - 2230948
Alignment:
| Q |
47 |
ggatcatgcacgtattctcagctcattttttctgtttcaacattttctaattcttgcatgcatgcatgctacc |
119 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
2230876 |
ggatcatgcatgtattctgagctcattttttctgtttcaacattttctaatttttgcatgcatgcatgctacc |
2230948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University