View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8180A_low_348 (Length: 212)
Name: NF8180A_low_348
Description: NF8180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8180A_low_348 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 24 - 164
Target Start/End: Complemental strand, 38207801 - 38207661
Alignment:
| Q |
24 |
aacagagacagtacgtttttggcgtgagactgagtctgagtgtgctaaaaacactcttaaaactttccctctttcgtcttccactctttttcctttacac |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38207801 |
aacagagacagtacgtttttggcgtgagactgagtctgagtgtgctaaaaacactcttaaaactttccctctttcgtcttccactctttttcctttacac |
38207702 |
T |
 |
| Q |
124 |
ttcatttcattctataaattgcaactccactacatttttct |
164 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
38207701 |
ttcatttcattctataaattgctactccactacatttttct |
38207661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University