View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8180A_low_353 (Length: 211)
Name: NF8180A_low_353
Description: NF8180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8180A_low_353 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 211
Target Start/End: Original strand, 9538539 - 9538748
Alignment:
| Q |
1 |
ggtatggttaatttggtgggaatgtaaagaacaaagaacaatgttgaggttaggatagatgcaataatgaaaattttgatatccatttgagagatggatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
9538539 |
ggtatggttaatttggtgggaatgtaaagaacaaagaacaatgttgaggttaggatagatgcaataatgaaaattttgatatccatttga-agatggatg |
9538637 |
T |
 |
| Q |
101 |
attgtgaagaaattaagtttgagaattggagagaaagttagaagaaaaaatgtatgagagttgagtaaagagtaatgaagaagtggttaaatgctttgat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
9538638 |
attgtgaagaaattaagtttgagaattggagaggaagttagaagaaaaaatatatgagagttgagtaaagagtcatgaagaagtggttaaatgctttgat |
9538737 |
T |
 |
| Q |
201 |
aaaggaactta |
211 |
Q |
| |
|
||||| ||||| |
|
|
| T |
9538738 |
aaagggactta |
9538748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University