View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8180A_low_355 (Length: 209)
Name: NF8180A_low_355
Description: NF8180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8180A_low_355 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 20 - 200
Target Start/End: Complemental strand, 37596615 - 37596435
Alignment:
| Q |
20 |
gtggtggaccagacttctttgtaagtttgggctagactttggtctatgcatagttttgtcttaaatgaattttgttgggccaagtattccaacctgtaac |
119 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37596615 |
gtggtcgatcagacttctttgtaagtttgggctagactttggtctatccatagttttgtctgaaatgaattttgttgggccaagtattccaacctgtaac |
37596516 |
T |
 |
| Q |
120 |
caaccaacataagccacccataaccactctagttgaatcgttttaccgcataaatcgctcgacatgacccgatattcttcg |
200 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37596515 |
caaccaacataagtcacccataaccactctagttgaatcgttttaccgcataaatcgctcgacatgacccgatattgttcg |
37596435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University