View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8180A_low_357 (Length: 208)
Name: NF8180A_low_357
Description: NF8180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8180A_low_357 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 30 - 173
Target Start/End: Complemental strand, 45922931 - 45922788
Alignment:
| Q |
30 |
caataaccggcattcctcctccttgcttagtgaagagttcgaaatggctgagcatccattttgttctgcaatgtaagttttcatttcgtttcatcctcta |
129 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45922931 |
caataacttgcattcctcctccttgcttagcgaagagttcgaaatggctgagcatccactttgttctgcaatgtaagttttcatttcgtttcatcctcta |
45922832 |
T |
|
| Q |
130 |
gaccagacgcggcaaatcatacatcatgcatattgtatgtttgg |
173 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
45922831 |
gaccagaagcggcaaatcatacatcatgcatattgtatgtttgg |
45922788 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University