View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8180A_low_358 (Length: 208)
Name: NF8180A_low_358
Description: NF8180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8180A_low_358 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 20 - 208
Target Start/End: Original strand, 32891866 - 32892054
Alignment:
| Q |
20 |
atccccccacccaacaatagacgtcgaaaagttccaaagagtgcgtttctcttggaacgctatggtccgcaagaattttctaacatgaccagaaaacttg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32891866 |
atccccccacccaacaatagacgtcgaaaagttccaaagagtgcgtttctcttggaacgctatggtccgcaagaattttctaacatgaccagaaaacttg |
32891965 |
T |
|
| Q |
120 |
tctccccatcttccatattgttcatggtttgactccgagtagtaatctcaacatcagcaatttgatgttcttcattgtattccaagttc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32891966 |
tctccccatcttccatattgttcatggtttgactccgagtagtaatctcaacatcaacaatttgatgttcttcattgtattccaagttc |
32892054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University