View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8180A_low_360 (Length: 207)
Name: NF8180A_low_360
Description: NF8180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8180A_low_360 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 7 - 207
Target Start/End: Complemental strand, 37566966 - 37566764
Alignment:
| Q |
7 |
ttaacatggtaatatatccttaattcctctgcttgttttcaacaatgttttaaaacccgaaacaaactagacggtttaaagaggttgaaccacgataaaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37566966 |
ttaacatggtaatatatccttaattcctctgcttgttttcaacaatcttttaaaacccgaatcaaactagacggtttaaagaggttgaaccacgataaaa |
37566867 |
T |
|
| Q |
107 |
agtcccactgattcg--attcggttcagtttttaaaacactgaatttagagtaaaaaatgtaacactaataccatgaggagtttactatatctataccta |
204 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
37566866 |
agtcccactgattcgatattcggttcagtttttaaaacactgaatttagagtaaaaaatgtaacactaataccatgaggagtttactatatctatatcta |
37566767 |
T |
|
| Q |
205 |
tat |
207 |
Q |
| |
|
||| |
|
|
| T |
37566766 |
tat |
37566764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University