View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8180A_low_363 (Length: 206)
Name: NF8180A_low_363
Description: NF8180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8180A_low_363 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 24 - 169
Target Start/End: Original strand, 36726546 - 36726691
Alignment:
| Q |
24 |
tgatcaccaattttgaatctacttccagccataaattcgaccattgatgtgagtttgcaatctctattgctctcatggctccagacaactcagcatgcaa |
123 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||||| ||||||| ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
36726546 |
tgatcaccaattctgaatctgcttccagccataatttcgaccgctgatgtgagtttgcaatctctattggtctcatggctccagacaactcgacatgcaa |
36726645 |
T |
 |
| Q |
124 |
ggaatttcccaaacatgtattttcaccaaagcaaagtagaaaatcc |
169 |
Q |
| |
|
||| |||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
36726646 |
ggagtttcccaaacctgtattttcaccaaagcaaagtagaaaatcc |
36726691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University