View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8180A_low_364 (Length: 206)
Name: NF8180A_low_364
Description: NF8180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8180A_low_364 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 23 - 182
Target Start/End: Original strand, 42492406 - 42492565
Alignment:
| Q |
23 |
tgttaggaaaaaggtttatgggcgatcctattgatggtggtccatgttttaatttttcttgcaaatttccttgtccacatgtgtcgctctttcataagat |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42492406 |
tgttaggaaaaaggtttatgggcgatcctattgatggtggtccatgttttaatttttcttgcaaatttccttgtccacatgtgtcgctctttcataagat |
42492505 |
T |
 |
| Q |
123 |
atagttatattcaacgaagttttttaaaaatgattataacaattttccatgatagtacac |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
42492506 |
atagttatattcaacgaagttttttaaaaatgattataacaattttccacgatagtacac |
42492565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University