View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8180A_low_367 (Length: 205)
Name: NF8180A_low_367
Description: NF8180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8180A_low_367 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 20 - 198
Target Start/End: Complemental strand, 27491795 - 27491617
Alignment:
| Q |
20 |
cttcacatgcgttacacacatttgtatcattattcagtaggaaatctctttgaaaatcagcaagtattaaacttattgaagagatcatgaagaatagaga |
119 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27491795 |
cttcacatgtgttacacacatttgtatcattattcagtaggaaatctctttgaaaatcaacaagtattaaacttattgaagagatcatgaagaatagaga |
27491696 |
T |
 |
| Q |
120 |
tcctcagataatagttgataccatatcccaattgctgacacatgatacagttgtatcatgctctttttgagaataatct |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||| |||| |
|
|
| T |
27491695 |
tcctcagataatagttgataccatatcccaattgctgacacatgatacaattgtatcatgctctttttgaaaatgatct |
27491617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University