View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8180A_low_377 (Length: 201)
Name: NF8180A_low_377
Description: NF8180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8180A_low_377 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 107; Significance: 8e-54; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 67 - 181
Target Start/End: Original strand, 3445974 - 3446088
Alignment:
| Q |
67 |
gatcacttgtgattatgacattaaaactgtgtctagccagcaaagaatatctatagtttcccatgatgtcaaatcaatttgatgcttcaaaacataattt |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
3445974 |
gatcacttgtgattatgacattaaaactgtgtctagccagcgaagaatatctatagtttcccatgatgtcaaatcaatttgatgcttcaaaacatatttt |
3446073 |
T |
|
| Q |
167 |
gttcacccacctacc |
181 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
3446074 |
gttcacccacctacc |
3446088 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University