View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8180A_low_378 (Length: 201)
Name: NF8180A_low_378
Description: NF8180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8180A_low_378 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 23 - 159
Target Start/End: Complemental strand, 23333995 - 23333859
Alignment:
| Q |
23 |
ggctggtgtgtaagattggaggtgggtggggtgctctttgcaaggcacggaggctgtaaccaaaacagccattgaagttgggtgtgactcatgaagcgga |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23333995 |
ggctggtgtgtaagattggaggtgggtggggtgctctttgcaaggcacggaggctgcaaccaaaacagccattgaagttgggtgtgactcatgaagcgga |
23333896 |
T |
|
| Q |
123 |
caataaggttgtctatctgaagcatgttccttttcca |
159 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
23333895 |
caataaggttgtctatctgaagcatcttcgttttcca |
23333859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University