View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8180A_low_47 (Length: 382)
Name: NF8180A_low_47
Description: NF8180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8180A_low_47 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 80 - 299
Target Start/End: Complemental strand, 41342404 - 41342185
Alignment:
| Q |
80 |
tctcattatataactttttggtttaggtaaaagattttgtgaagttaaataatttatattatgctgggagtcatggtatggacataatggcaccatcagg |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41342404 |
tctcattatataactttttggtttaggtaaaagattttgtgaagttaaataatttatattatgctgggagtcatggtatggacataatggcaccatcagg |
41342305 |
T |
|
| Q |
180 |
accaattagatcttctgacggcaacctccaatgctacaacaacactcttgacacaaatgtgagtaattccatttgtgccaatatactttaaccattttta |
279 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41342304 |
accaattagatcttctgacggcaaccaccaatgctacaacaacactcttgacacaaatgtgagtaattccatttgtgccaatatactttaaccattttta |
41342205 |
T |
|
| Q |
280 |
attagagcatttgattctta |
299 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
41342204 |
attagagcatttgattctta |
41342185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University