View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8180A_low_53 (Length: 370)
Name: NF8180A_low_53
Description: NF8180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8180A_low_53 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 362; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 362; E-Value: 0
Query Start/End: Original strand, 1 - 370
Target Start/End: Complemental strand, 44577859 - 44577490
Alignment:
| Q |
1 |
gtggcagagatttagcaagcaaaaggaccgggagttggagaagctgagtctagaaaacgaaagaatgaagcttgaaaatgaacatatggctttagaactg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
44577859 |
gtggcagagatttagcaagcaaaaggaccgggagttggagaagctgagtctagaaaacgaaagaatgaagcttgaaaatgaacgtatggctttagaactg |
44577760 |
T |
|
| Q |
101 |
aagcaaaaggaaatgagtctcggctttaactaggtcagcaatcttgcaaactttgtggtaggatgtaatttatttatttagatgaaataatgaatatttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44577759 |
aagcaaaaggaaatgagtctcggctttaactaggtcagcaatcttgcaaactttgtggtaggatgtaatttatttatttagatgaaataatgaatatttt |
44577660 |
T |
|
| Q |
201 |
attgggaaactttggaccatttgagtatgttaatttggcaactccggatagttatagttttgctcaatgattactttactgaagttttgttgcctgtgtt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44577659 |
attgggaaactttggaccatttgagtatgttaatttggcaactccggatagttatagttttgctcaatgattactttactgaagttttgttgcctgtgtt |
44577560 |
T |
|
| Q |
301 |
tctattattatatattgtctgctgtttcatttatatcattatgcttatttttcattctccaaatttttga |
370 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44577559 |
tctattattatatattttctgctgtttcatttatatcattatgcttatttttcattctccaaatttttga |
44577490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 1 - 111
Target Start/End: Original strand, 12638537 - 12638647
Alignment:
| Q |
1 |
gtggcagagatttagcaagcaaaaggaccgggagttggagaagctgagtctagaaaacgaaagaatgaagcttgaaaatgaacatatggctttagaactg |
100 |
Q |
| |
|
|||| |||| ||||||||| |||| ||||| |||||||||||| | | || ||||| || ||||||||| |||| ||||||| ||| ||||||||||| |
|
|
| T |
12638537 |
gtgggagaggtttagcaagaaaaaagaccgagagttggagaagttcaagctggaaaatgacagaatgaagattgagaatgaacgtattgctttagaacta |
12638636 |
T |
|
| Q |
101 |
aagcaaaagga |
111 |
Q |
| |
|
|||| |||||| |
|
|
| T |
12638637 |
aagcgaaagga |
12638647 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University