View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8180A_low_81 (Length: 314)
Name: NF8180A_low_81
Description: NF8180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8180A_low_81 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 26 - 293
Target Start/End: Original strand, 36525681 - 36525948
Alignment:
| Q |
26 |
aacttttaatcctgtactgtggcttgacgttccttaattgtttttaagtactataatttgtcgatttgcagtagtgtggtggattgccttcgtacctttc |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36525681 |
aacttttaatcctgtactgtggcttgacgttccttaattgtttttaagtactataatttgtcgatttgcagtagtgtggtggattgccttcgtacctttc |
36525780 |
T |
|
| Q |
126 |
ccaagttcatttttcaaataaattatcaatttagtccctaaactattaccatttctcctattcagtctcttaactctataaatataataatcagtgccta |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
36525781 |
ccaagttcatttttcaaataaattatcaatttagtccctaaactattaccatttctcctattcaatctctaaactctataaatataataatcagtgccta |
36525880 |
T |
|
| Q |
226 |
acttcgtcccttatagtctttaatatcttaatagcagagactaaattgacatatttatattatttagg |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
36525881 |
acttcgtcccttatagtctttaatatcttaatagcaaagactaaattgacatatttatattatttagg |
36525948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 275
Target Start/End: Original strand, 22559536 - 22559574
Alignment:
| Q |
237 |
tatagtctttaatatcttaatagcagagactaaattgac |
275 |
Q |
| |
|
|||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
22559536 |
tatagtctctaacatcttaatagcagagactaaattgac |
22559574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University