View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8180A_low_86 (Length: 308)
Name: NF8180A_low_86
Description: NF8180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8180A_low_86 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 37 - 308
Target Start/End: Complemental strand, 10316626 - 10316355
Alignment:
| Q |
37 |
cactagtgtttatacatgcatagaattctattgtcccattttaaaatactagttgatgttcaaaggaataaatacactggatatgcagtgacaaagttgt |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10316626 |
cactagtgtttatacatgcatagaattctattgtcccattttaaaatactagttgatgttcaaaggaataaatacactggatatgcagtgacaaagttgt |
10316527 |
T |
|
| Q |
137 |
atttgaaaggcttctttattttgctgtgtgattcaatatggttagatcgtcagaatttgaactgtcatctgagagtatcattcagcctttatttggtttt |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
10316526 |
atttgaaaggcttctttattttgctgtgtgattcaatatggttagatcgtcagaatttgaactgtcatctgagagtatcattcagcctttatttgggttt |
10316427 |
T |
|
| Q |
237 |
tagactttctggaaccagaaaagaaagagtttaggtcttttggatatatcattatatgtacaaataagttga |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
10316426 |
tagactttctggaaccagaaaagaaagagtttaggtcttttggatatatcatcatatgtacaaataagttga |
10316355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University