View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8180A_low_96 (Length: 300)
Name: NF8180A_low_96
Description: NF8180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8180A_low_96 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 8 - 293
Target Start/End: Original strand, 26734318 - 26734603
Alignment:
| Q |
8 |
ctgtgtaagggataatgttactgtggtggtgattagtatagtgagtaccttttaggttgtttagctgtttatggatgcgcctcctttttggcctctgggt |
107 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26734318 |
ctgtgtaagggataatgttattatggtggtgattagtatagtgagtaccttttaggttgtttagctgtttatggatgcgcctcctttttggcctctgggt |
26734417 |
T |
|
| Q |
108 |
gttttttccaatgttgtattatatagttcttgtcacgtcttgtgtcgatgctaataaataaaatttgtcgttgnnnnnnnnnntgaataagtggagaatt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
26734418 |
gttttttccaatgttgtattatatagttcttgtcacgtcttctgtcgatgctaataaataaaatttgtcgttgaaaaaaaaaatgaataagaggagaatc |
26734517 |
T |
|
| Q |
208 |
tagatttgaacacgtcctacatataaaatacaatgtccctgtcaactaagttatggttatgggacaaatattttctctctctgtta |
293 |
Q |
| |
|
| |||||||||||||||||||| ||||||||||||| || ||||||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
26734518 |
tggatttgaacacgtcctacatgtaaaatacaatgtttctaccaactaagttatggtcatgggacaaatattttctctctttgtta |
26734603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University