View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8180_high_2 (Length: 219)
Name: NF8180_high_2
Description: NF8180
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8180_high_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 65 - 198
Target Start/End: Original strand, 1256569 - 1256702
Alignment:
| Q |
65 |
tcaatttacatttttccctccctaattccaccattacaagcccatatctaaataaaaactacaagcccctatttcagtttctacaacttttgttaattag |
164 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
1256569 |
tcaatttacacttttccctccctaattccaccattacaagcctatatctaaataaaaactacaagcccctgtttcagtttctacaacttttgtcaattag |
1256668 |
T |
 |
| Q |
165 |
gaaaagccgaaacataatcataaaatgcagtaac |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
1256669 |
gaaaagccgaaacataatcataaaatgcagtaac |
1256702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University