View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8180_low_6 (Length: 219)

Name: NF8180_low_6
Description: NF8180
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8180_low_6
NF8180_low_6
[»] chr3 (1 HSPs)
chr3 (65-198)||(1256569-1256702)


Alignment Details
Target: chr3 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 65 - 198
Target Start/End: Original strand, 1256569 - 1256702
Alignment:
65 tcaatttacatttttccctccctaattccaccattacaagcccatatctaaataaaaactacaagcccctatttcagtttctacaacttttgttaattag 164  Q
    |||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||    
1256569 tcaatttacacttttccctccctaattccaccattacaagcctatatctaaataaaaactacaagcccctgtttcagtttctacaacttttgtcaattag 1256668  T
165 gaaaagccgaaacataatcataaaatgcagtaac 198  Q
    ||||||||||||||||||||||||||||||||||    
1256669 gaaaagccgaaacataatcataaaatgcagtaac 1256702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University