View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8181_high_3 (Length: 372)
Name: NF8181_high_3
Description: NF8181
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8181_high_3 |
 |  |
|
| [»] chr6 (18 HSPs) |
 |  |
|
| [»] scaffold0009 (1 HSPs) |
 |  |  |
|
| [»] scaffold0068 (1 HSPs) |
 |  |  |
|
| [»] scaffold0437 (1 HSPs) |
 |  |  |
|
| [»] scaffold0291 (2 HSPs) |
 |  |  |
|
| [»] scaffold0013 (1 HSPs) |
 |  |  |
|
| [»] scaffold0911 (1 HSPs) |
 |  |  |
|
| [»] scaffold0886 (1 HSPs) |
 |  |  |
|
| [»] scaffold0176 (2 HSPs) |
 |  |  |
|
| [»] scaffold0257 (1 HSPs) |
 |  |  |
|
| [»] scaffold0045 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 92; Significance: 1e-44; HSPs: 13)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 1 - 250
Target Start/End: Complemental strand, 10032325 - 10032075
Alignment:
| Q |
1 |
tatggatttcttttgtgacaaaattggtttgcctaactacaggtttcctttctctcgtgtagtctatttgcgttttgttatttactt---attttcttct |
97 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||| |||||||| ||||| |||| || |||| || ||||||||| |
|
|
| T |
10032325 |
tatggatttcttttgtgacaaagttggtttgcctaactacaggtttccttactctgttgtagtctgtttgcattttattttttattttttattttcttcc |
10032226 |
T |
 |
| Q |
98 |
g--ggttttgatctagtcccccctcttcttgtatatannnnnnnnnnnnnnnaataatattttagagttggcagcataggatggaggttttctggggtac |
195 |
Q |
| |
|
| ||||||| ||||||||||||||||||||| ||| |||||||||||||||||||| |||||||||| || ||||| |||||| |
|
|
| T |
10032225 |
gagggttttggcctagtcccccctcttcttgtacatatttttcctttt----aataatattttagagttggcggcataggatgaagtttttccggggtat |
10032130 |
T |
 |
| Q |
196 |
caacctagttgggatgttggtgttttctcttgatgcatatcccttctccttgcct |
250 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||| | |||||||||||||||| |
|
|
| T |
10032129 |
caacctagttgggatgtcggtgtttcctcttgatgcctgtcccttctccttgcct |
10032075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 149 - 231
Target Start/End: Complemental strand, 34529008 - 34528925
Alignment:
| Q |
149 |
ataatattttagagtt-ggcagcataggatggaggttttctggggtaccaacctagttgggatgttggtgttttctcttgatgc |
231 |
Q |
| |
|
|||| ||||||||||| ||| ||||||||||||||||| | ||||| |||||||||||||||||| | ||||| |||||||||| |
|
|
| T |
34529008 |
ataaaattttagagtttggcggcataggatggaggtttcccggggtgccaacctagttgggatgtcgctgtttcctcttgatgc |
34528925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 163 - 231
Target Start/End: Complemental strand, 18332775 - 18332707
Alignment:
| Q |
163 |
ttggcagcataggatggaggttttctggggtaccaacctagttgggatgttggtgttttctcttgatgc |
231 |
Q |
| |
|
||||| |||||||||||||||| || ||||| |||||||||||||||||| | ||||||||||| |||| |
|
|
| T |
18332775 |
ttggcggcataggatggaggttctccggggtgccaacctagttgggatgtcgatgttttctcttaatgc |
18332707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 148 - 250
Target Start/End: Complemental strand, 41574388 - 41574286
Alignment:
| Q |
148 |
aataatattttagagtt-ggcagcataggatggaggttttctggggtaccaacctagttgggatgttggtgttttctcttgatgcatatcccttctcctt |
246 |
Q |
| |
|
||||| ||||||||||| ||| ||||||||||||||||| | ||| | ||||||||||||||||||||||||| || |||||| | ||| |||||||| |
|
|
| T |
41574388 |
aataaaattttagagtttggcggcataggatggaggtttccaggg-tgtcaacctagttgggatgttggtgtttccttttgatgtctgtcctttctcctt |
41574290 |
T |
 |
| Q |
247 |
gcct |
250 |
Q |
| |
|
|||| |
|
|
| T |
41574289 |
gcct |
41574286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 171 - 233
Target Start/End: Complemental strand, 19054451 - 19054389
Alignment:
| Q |
171 |
ataggatggaggttttctggggtaccaacctagttgggatgttggtgttttctcttgatgcat |
233 |
Q |
| |
|
|||||||||||||| | ||||| |||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
19054451 |
ataggatggaggttccccggggtgccaacctagttgggatgtcggtgtttcctcttgatgcat |
19054389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 169 - 233
Target Start/End: Complemental strand, 16816302 - 16816238
Alignment:
| Q |
169 |
gcataggatggaggttttctggggtaccaacctagttgggatgttggtgttttctcttgatgcat |
233 |
Q |
| |
|
|||||||||||||||| | | || |||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
16816302 |
gcataggatggaggttccccgaggcgccaacctagttgggatgttggtgtttcctcttgatgcat |
16816238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 245
Target Start/End: Original strand, 10433201 - 10433283
Alignment:
| Q |
163 |
ttggcagcataggatggaggttttctggggtaccaacctagttgggatgttggtgttttctcttgatgcatatcccttctcct |
245 |
Q |
| |
|
||||||||||| |||||||||| || | ||| | |||||||||||||||| |||| || |||||||||| | ||| ||||||| |
|
|
| T |
10433201 |
ttggcagcatatgatggaggttctccgaggtgcaaacctagttgggatgtcggtgcttcctcttgatgcttgtcctttctcct |
10433283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 148 - 224
Target Start/End: Complemental strand, 12629339 - 12629262
Alignment:
| Q |
148 |
aataatattttagagtt-ggcagcataggatggaggttttctggggtaccaacctagttgggatgttggtgttttctc |
224 |
Q |
| |
|
||||| ||||||||||| ||| |||||||| |||||||| | ||| | |||| ||||||||||||| ||||||||||| |
|
|
| T |
12629339 |
aataaaattttagagtttggcggcataggacggaggtttcccgggatgccaatctagttgggatgtcggtgttttctc |
12629262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 148 - 223
Target Start/End: Complemental strand, 34880006 - 34879930
Alignment:
| Q |
148 |
aataatattttagagttgg-cagcataggatggaggttttctggggtaccaacctagttgggatgttggtgttttct |
223 |
Q |
| |
|
||||| |||||||||||| || ||||||| ||||||||| ||||| ||||||||||| |||||| |||||||||| |
|
|
| T |
34880006 |
aataaaattttagagttgtacaacataggacggaggtttttcggggtgccaacctagttaggatgtcggtgttttct |
34879930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 148 - 233
Target Start/End: Complemental strand, 43021826 - 43021739
Alignment:
| Q |
148 |
aataatattttagagtt-ggcagcataggatggaggttttct-ggggtaccaacctagttgggatgttggtgttttctcttgatgcat |
233 |
Q |
| |
|
||||| ||||||||||| ||| ||||||||||||||||| | ||||| |||||||| ||| ||| |||||||||||||||||||| |
|
|
| T |
43021826 |
aataaaattttagagtttggcggcataggatggaggtttccccggggtgccaacctaagtggtttgtcggtgttttctcttgatgcat |
43021739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 268 - 325
Target Start/End: Original strand, 8753449 - 8753511
Alignment:
| Q |
268 |
tagaagagagcattttt---ataggtagtgcataagttttc--atatatgaaaaatggtgtta |
325 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||| ||||||| |||||||||||| |
|
|
| T |
8753449 |
tagaagagagcattttttatataggtagtgcacaagttttcatatatatgtaaaatggtgtta |
8753511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 171 - 212
Target Start/End: Complemental strand, 25538825 - 25538784
Alignment:
| Q |
171 |
ataggatggaggttttctggggtaccaacctagttgggatgt |
212 |
Q |
| |
|
|||||||||||||| ||||| || |||||||||||||||||| |
|
|
| T |
25538825 |
ataggatggaggttctctggagtgccaacctagttgggatgt |
25538784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 169 - 214
Target Start/End: Original strand, 41917088 - 41917133
Alignment:
| Q |
169 |
gcataggatggaggttttctggggtaccaacctagttgggatgttg |
214 |
Q |
| |
|
||||||||||| |||| || ||||| |||||||||||||||||||| |
|
|
| T |
41917088 |
gcataggatgggggttctccggggtgccaacctagttgggatgttg |
41917133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 91; Significance: 5e-44; HSPs: 18)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 271 - 372
Target Start/End: Complemental strand, 15951985 - 15951883
Alignment:
| Q |
271 |
aagagagcatt-tttataggtagtgcataagttttcatatatgaaaaatggtgttattggtcttcaaattaaaaggaacgtaaccactatataaaagtat |
369 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15951985 |
aagagagcattatttataggtagtgcataagttttcatatatgaaaaatgttgttattggtcttcaaattaaaaggaacgtaaccactatataaaagtat |
15951886 |
T |
 |
| Q |
370 |
tat |
372 |
Q |
| |
|
||| |
|
|
| T |
15951885 |
tat |
15951883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 148 - 248
Target Start/End: Original strand, 20898950 - 20899051
Alignment:
| Q |
148 |
aataatattttagagtt-ggcagcataggatggaggttttctggggtaccaacctagttgggatgttggtgttttctcttgatgcatatcccttctcctt |
246 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||||| ||||||| |||||||||||||||||| |||||| |||||||||| | ||| ||||||| |
|
|
| T |
20898950 |
aataatattttagagtttggcagcatagggtggaggtttcctggggtgccaacctagttgggatgtcggtgttgcctcttgatgcttgtcctctctcctt |
20899049 |
T |
 |
| Q |
247 |
gc |
248 |
Q |
| |
|
|| |
|
|
| T |
20899050 |
gc |
20899051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 174 - 233
Target Start/End: Complemental strand, 24617796 - 24617737
Alignment:
| Q |
174 |
ggatggaggttttctggggtaccaacctagttgggatgttggtgttttctcttgatgcat |
233 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
24617796 |
ggatggaggttttccggggtgccaacctagttgggatgtcggtgtttcctcttgatgcat |
24617737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 148 - 243
Target Start/End: Original strand, 24373503 - 24373599
Alignment:
| Q |
148 |
aataatattttagag-ttggcagcataggatggaggttttctggggtaccaacctagttgggatgttggtgttttctcttgatgcatatcccttctc |
243 |
Q |
| |
|
||||||||||| ||| ||||| |||||||||||||||| || ||||||||||||||||||||||| ||| || ||| |||||||| ||| ||||| |
|
|
| T |
24373503 |
aataatatttttgagattggcggcataggatggaggttctccagggtaccaacctagttgggatgtcagtgcttcctcgtgatgcatgtcctttctc |
24373599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 248
Target Start/End: Original strand, 3056941 - 3057026
Alignment:
| Q |
163 |
ttggcagcataggatggaggttttctggggtaccaacctagttgggatgttggtgttttctcttgatgcatatcccttctccttgc |
248 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||| |||||||||||| | |||| ||||||||||| | ||| ||||||||| |
|
|
| T |
3056941 |
ttggcggcataggatggaggtttctcggggtaccaacttagttgggatgtcgatgttgtctcttgatgcctgtccactctccttgc |
3057026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 151 - 230
Target Start/End: Original strand, 9344469 - 9344549
Alignment:
| Q |
151 |
aatattttagagtt-ggcagcataggatggaggttttctggggtaccaacctagttgggatgttggtgttttctcttgatg |
230 |
Q |
| |
|
|||||||| ||||| || |||||||| |||||||||| || || |||||||||||||||||| | ||||||||||||||| |
|
|
| T |
9344469 |
aatatttttgagtttggaagcatagggtggaggttttgcggagtgccaacctagttgggatgtcgttgttttctcttgatg |
9344549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 155 - 230
Target Start/End: Original strand, 14641431 - 14641507
Alignment:
| Q |
155 |
ttttagag-ttggcagcataggatggaggttttctggggtaccaacctagttgggatgttggtgttttctcttgatg |
230 |
Q |
| |
|
|||||||| ||||| |||||||||||||| || | ||||| |||||||||||||||||| |||||| ||||||||| |
|
|
| T |
14641431 |
ttttagagattggcggcataggatggagggttcccggggtgccaacctagttgggatgtcggtgttccctcttgatg |
14641507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 233
Target Start/End: Complemental strand, 9351198 - 9351128
Alignment:
| Q |
163 |
ttggcagcataggatggaggttttctggggtaccaacctagttgggatgttggtgttttctcttgatgcat |
233 |
Q |
| |
|
||||| ||||||||||||||||| ||||| |||||||||||||||||| | |||| ||| ||||||||| |
|
|
| T |
9351198 |
ttggcggcataggatggaggtttctcggggtgccaacctagttgggatgtcgatgttgtctattgatgcat |
9351128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 233
Target Start/End: Complemental strand, 26592596 - 26592526
Alignment:
| Q |
163 |
ttggcagcataggatggaggttttctggggtaccaacctagttgggatgttggtgttttctcttgatgcat |
233 |
Q |
| |
|
||||| ||||||||||||||||| | ||||||||||||||||| |||| ||||| ||||||||||||| |
|
|
| T |
26592596 |
ttggcggcataggatggaggtttcccaaggtaccaacctagttggaatgtcagtgttctctcttgatgcat |
26592526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 170 - 233
Target Start/End: Complemental strand, 841372 - 841308
Alignment:
| Q |
170 |
cataggatggaggttttct-ggggtaccaacctagttgggatgttggtgttttctcttgatgcat |
233 |
Q |
| |
|
||||||||||||||| || ||||| ||||| |||||||||||| ||||||||||| |||||||| |
|
|
| T |
841372 |
cataggatggaggttccctcggggtgccaacttagttgggatgtcggtgttttctcatgatgcat |
841308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 163 - 222
Target Start/End: Original strand, 11650843 - 11650902
Alignment:
| Q |
163 |
ttggcagcataggatggaggttttctggggtaccaacctagttgggatgttggtgttttc |
222 |
Q |
| |
|
||||| ||||| |||||||||| || |||| |||||||||||||||||| ||||||||| |
|
|
| T |
11650843 |
ttggcggcataagatggaggttccctagggtgccaacctagttgggatgtaggtgttttc |
11650902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 171 - 233
Target Start/End: Complemental strand, 8483698 - 8483636
Alignment:
| Q |
171 |
ataggatggaggttttctggggtaccaacctagttgggatgttggtgttttctcttgatgcat |
233 |
Q |
| |
|
||||||| |||||| | ||||| |||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
8483698 |
ataggatagaggttccccggggtgccaacctagttgggatgtccgtgtttcctcttgatgcat |
8483636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 171 - 233
Target Start/End: Original strand, 13575013 - 13575075
Alignment:
| Q |
171 |
ataggatggaggttttctggggtaccaacctagttgggatgttggtgttttctcttgatgcat |
233 |
Q |
| |
|
|||||||| |||||| | || || |||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
13575013 |
ataggatgaaggtttcccggagtgccaacctagttgggatgtcggtgttccctcttgatgcat |
13575075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 171 - 233
Target Start/End: Original strand, 13577552 - 13577614
Alignment:
| Q |
171 |
ataggatggaggttttctggggtaccaacctagttgggatgttggtgttttctcttgatgcat |
233 |
Q |
| |
|
|||||||| |||||| | || || |||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
13577552 |
ataggatgaaggtttcccggagtgccaacctagttgggatgtcggtgttccctcttgatgcat |
13577614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 232
Target Start/End: Complemental strand, 15141979 - 15141909
Alignment:
| Q |
162 |
gttggcagcataggatggaggttttctggggtaccaacctagttgggatgttggtgttttctcttgatgca |
232 |
Q |
| |
|
|||||| ||| | |||| |||||| | ||| | |||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
15141979 |
gttggcggcagacgatgcaggtttcccgggttgccaacctagttgggatgtcggtgtttcctcttgatgca |
15141909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 204 - 250
Target Start/End: Complemental strand, 15952056 - 15952010
Alignment:
| Q |
204 |
ttgggatgttggtgttttctcttgatgcatatcccttctccttgcct |
250 |
Q |
| |
|
||||||||| ||||||||||||| ||| || |||||||||||||||| |
|
|
| T |
15952056 |
ttgggatgtcggtgttttctcttaatgtatgtcccttctccttgcct |
15952010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 148 - 245
Target Start/End: Original strand, 20589622 - 20589719
Alignment:
| Q |
148 |
aataatattttagagt-tggcagcataggatggaggttttctggggtaccaacctagttgggatgttggtgttttctcttgatgcatatcccttctcct |
245 |
Q |
| |
|
||||||||||| |||| |||| |||||||||||||||| || ||||| |||||||||||| ||||| || | | |||||||||| | ||| ||||||| |
|
|
| T |
20589622 |
aataatatttt-gagtctggcggcataggatggaggttctccggggtgccaacctagttgagatgtcggaggtccctcttgatgcctgtcctttctcct |
20589719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 163 - 212
Target Start/End: Original strand, 12435958 - 12436007
Alignment:
| Q |
163 |
ttggcagcataggatggaggttttctggggtaccaacctagttgggatgt |
212 |
Q |
| |
|
||||| ||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
12435958 |
ttggcggcataggatggaggtttgtcggggtgccaacctagttgggatgt |
12436007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 57; Significance: 1e-23; HSPs: 7)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 280 - 369
Target Start/End: Original strand, 13437897 - 13437988
Alignment:
| Q |
280 |
tttttataggtagtgcataagttttcatata--tgaaaaatggtgttattggtcttcaaattaaaaggaacgtaaccactatataaaagtat |
369 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||| |||| || ||||||||||||||||| || ||||| |||||||| |
|
|
| T |
13437897 |
tttttataggtagtgcataagttttcatatacatgaaaaatggtgttactggtattgaaattaaaaggaacgtatcctctatagaaaagtat |
13437988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 163 - 233
Target Start/End: Complemental strand, 40926535 - 40926465
Alignment:
| Q |
163 |
ttggcagcataggatggaggttttctggggtaccaacctagttgggatgttggtgttttctcttgatgcat |
233 |
Q |
| |
|
||||| ||||||||||||||||| | ||||| |||||||||||||||||| | ||||| ||| |||||||| |
|
|
| T |
40926535 |
ttggcggcataggatggaggtttcccggggtgccaacctagttgggatgtcgatgtttcctcctgatgcat |
40926465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 148 - 233
Target Start/End: Complemental strand, 13619183 - 13619098
Alignment:
| Q |
148 |
aataatattttagagttggcagcataggatggaggttttctggggtaccaacctagttgggatgttggtgttttctcttgatgcat |
233 |
Q |
| |
|
||||||||||| | || || |||||||||||||||| || | | | ||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
13619183 |
aataatatttttaatttagcggcataggatggaggttctccgagttgccaacctagttgggatgttagtgtttcctcttgatgcat |
13619098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 230
Target Start/End: Original strand, 28522856 - 28522923
Alignment:
| Q |
163 |
ttggcagcataggatggaggttttctggggtaccaacctagttgggatgttggtgttttctcttgatg |
230 |
Q |
| |
|
||||| |||||||||||||||| ||| |||| |||||||||||||||||| ||||| ||||||||| |
|
|
| T |
28522856 |
ttggcggcataggatggaggttctctagggtgccaacctagttgggatgtcaatgtttcctcttgatg |
28522923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 148 - 233
Target Start/End: Complemental strand, 17377596 - 17377510
Alignment:
| Q |
148 |
aataatattttagagtt-ggcagcataggatggaggttttctggggtaccaacctagttgggatgttggtgttttctcttgatgcat |
233 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||| |||||| |||||||||||| ||| | | |||| |||||||||||| |
|
|
| T |
17377596 |
aataatattttagagtttggcgtcataggatggaggtttcttggggtgccaacctagttgagatatcgttgttgcctcttgatgcat |
17377510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 163 - 248
Target Start/End: Original strand, 17151299 - 17151384
Alignment:
| Q |
163 |
ttggcagcataggatggaggttttctggggtaccaacctagttgggatgttggtgttttctcttgatgcatatcccttctccttgc |
248 |
Q |
| |
|
||||| ||||||||||||||||| | || || ||||||||||||| |||| |||||| ||| |||||| ||||| | |||||||| |
|
|
| T |
17151299 |
ttggcggcataggatggaggtttcccggagtgccaacctagttggcatgtcagtgtttcctcctgatgcctatccttactccttgc |
17151384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 148 - 212
Target Start/End: Complemental strand, 24270907 - 24270842
Alignment:
| Q |
148 |
aataatattttagagttgg-cagcataggatggaggttttctggggtaccaacctagttgggatgt |
212 |
Q |
| |
|
||||| ||||||||||| | ||||||||||||||||||| | | || |||||||||||||||||| |
|
|
| T |
24270907 |
aataaaattttagagtttgacagcataggatggaggtttcccgcagtgccaacctagttgggatgt |
24270842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 54; Significance: 6e-22; HSPs: 10)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 148 - 248
Target Start/End: Original strand, 16290844 - 16290945
Alignment:
| Q |
148 |
aataatattttagagtt-ggcagcataggatggaggttttctggggtaccaacctagttgggatgttggtgttttctcttgatgcatatcccttctcctt |
246 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| | ||||| |||||||||||||||||| |||||| ||||||||| | ||| |||||||| |
|
|
| T |
16290844 |
aataatattttagagtttggcagcataggatggaggtttcccggggtgccaacctagttgggatgtcggtgttgcctcttgatgtttgtcctttctcctt |
16290943 |
T |
 |
| Q |
247 |
gc |
248 |
Q |
| |
|
|| |
|
|
| T |
16290944 |
gc |
16290945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 148 - 224
Target Start/End: Complemental strand, 16325708 - 16325633
Alignment:
| Q |
148 |
aataatattttagagttggcagcataggatggaggttttctggggtaccaacctagttgggatgttggtgttttctc |
224 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||||||||| ||| |||||||||||| |||| |||||||||| |
|
|
| T |
16325708 |
aataaaattttagagt-ggcggcataggatggaggttttctgaggtgccaacctagttgaaatgtcagtgttttctc |
16325633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 169 - 248
Target Start/End: Original strand, 26657677 - 26657756
Alignment:
| Q |
169 |
gcataggatggaggttttctggggtaccaacctagttgggatgttggtgttttctcttgatgcatatcccttctccttgc |
248 |
Q |
| |
|
||||||||||||||||| | | || ||||| |||||||||||| ||||||| |||||||||||| ||| ||||||||| |
|
|
| T |
26657677 |
gcataggatggaggtttcccgaagtgccaacttagttgggatgtcggtgtttcctcttgatgcatgtcctctctccttgc |
26657756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 250
Target Start/End: Complemental strand, 21499416 - 21499327
Alignment:
| Q |
163 |
ttggcagcataggatggaggttttctggggtaccaacctagttgggatgttggtgt--tttctcttgatgcatatcccttctccttgcct |
250 |
Q |
| |
|
||||| || |||||| ||||||||||| ||| |||||||||||||||||| ||||| | ||||||||| | ||||| ||||||||||| |
|
|
| T |
21499416 |
ttggcggcgtaggattgaggttttctgcggtgccaacctagttgggatgtcggtgttgtgtctcttgatacctatcctctctccttgcct |
21499327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 148 - 233
Target Start/End: Original strand, 29840849 - 29840935
Alignment:
| Q |
148 |
aataatattttagag-ttggcagcataggatggaggttttctggggtaccaacctagttgggatgttggtgttttctcttgatgcat |
233 |
Q |
| |
|
||||| ||||||||| ||||| ||||| ||||||||||| ||||| |||||||||||||||||| | |||| | ||||||||||| |
|
|
| T |
29840849 |
aataaaattttagagattggcggcatatgatggaggtttctcggggtgccaacctagttgggatgtcgatgttgtttcttgatgcat |
29840935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 163 - 232
Target Start/End: Original strand, 44351 - 44420
Alignment:
| Q |
163 |
ttggcagcataggatggaggttttctggggtaccaacctagttgggatgttggtgttttctcttgatgca |
232 |
Q |
| |
|
||||| |||||| |||||||||| | |||||||||||||| ||||||| | ||||||| || |||||||| |
|
|
| T |
44351 |
ttggctgcatagtatggaggtttcccggggtaccaacctaattgggatttcggtgtttccttttgatgca |
44420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 155 - 230
Target Start/End: Complemental strand, 24184834 - 24184758
Alignment:
| Q |
155 |
ttttagag-ttggcagcataggatggaggttttctggggtaccaacctagttgggatgttggtgttttctcttgatg |
230 |
Q |
| |
|
|||||||| ||||| |||||||||||||| || | ||| | |||||||||||||||||| |||||| ||||||||| |
|
|
| T |
24184834 |
ttttagagattggcggcataggatggagggttcccgggatgccaacctagttgggatgtcggtgttccctcttgatg |
24184758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 163 - 230
Target Start/End: Original strand, 24317404 - 24317470
Alignment:
| Q |
163 |
ttggcagcataggatggaggttttctggggtaccaacctagttgggatgttggtgttttctcttgatg |
230 |
Q |
| |
|
||||| ||||||||| |||||| | ||||| ||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
24317404 |
ttggcggcataggatagaggttccc-ggggtgccaacctagttggtatgttggtgtttcctcttgatg |
24317470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 173 - 230
Target Start/End: Original strand, 19742056 - 19742113
Alignment:
| Q |
173 |
aggatggaggttttctggggtaccaacctagttgggatgttggtgttttctcttgatg |
230 |
Q |
| |
|
|||||||||| || | ||||| |||||||||||||||||| |||||| |||| ||||| |
|
|
| T |
19742056 |
aggatggaggcttcccggggtgccaacctagttgggatgtcggtgttgtctcctgatg |
19742113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 163 - 227
Target Start/End: Complemental strand, 26393416 - 26393352
Alignment:
| Q |
163 |
ttggcagcataggatggaggttttctggggtaccaacctagttgggatgttggtgttttctcttg |
227 |
Q |
| |
|
||||| ||||||||||||||||| ||||| |||| |||||||||||| | |||||||||||| |
|
|
| T |
26393416 |
ttggcggcataggatggaggtttcgcggggtggcaacttagttgggatgtcgttgttttctcttg |
26393352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 51; Significance: 4e-20; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 148 - 249
Target Start/End: Complemental strand, 1584 - 1482
Alignment:
| Q |
148 |
aataatattttagagtt-ggcagcataggatggaggttttctggggtaccaacctagttgggatgttggtgttttctcttgatgcatatcccttctcctt |
246 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||| | ||||| |||||||||||||||||| |||||| |||||||||| | ||| ||||||| |
|
|
| T |
1584 |
aataatattttagagtttggaagcataggatggaggtttcccggggtgccaacctagttgggatgtcggtgttgcctcttgatgcttgtcctctctcctt |
1485 |
T |
 |
| Q |
247 |
gcc |
249 |
Q |
| |
|
||| |
|
|
| T |
1484 |
gcc |
1482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 49; Significance: 6e-19; HSPs: 8)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 148 - 231
Target Start/End: Original strand, 25760008 - 25760092
Alignment:
| Q |
148 |
aataatattttagagtt-ggcagcataggatggaggttttctggggtaccaacctagttgggatgttggtgttttctcttgatgc |
231 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| | || |||||||||||||||||| |||||| |||||||||| |
|
|
| T |
25760008 |
aataatattttagagtttggcagcataggatggaggttttccgaagtgccaacctagttgggatgtcggtgttgcctcttgatgc |
25760092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 148 - 250
Target Start/End: Complemental strand, 26954041 - 26953938
Alignment:
| Q |
148 |
aataatattttagagtt-ggcagcataggatggaggttttctggggtaccaacctagttgggatgttggtgttttctcttgatgcatatcccttctcctt |
246 |
Q |
| |
|
||||| ||||||||||| ||| ||||| ||||||||||||||| | | |||||||||||||||||| ||||||| |||||||||||| || ||||||| |
|
|
| T |
26954041 |
aataaaattttagagtttggcggcatatgatggaggttttctgagatgccaacctagttgggatgtcggtgtttcctcttgatgcatgtcgtctctcctt |
26953942 |
T |
 |
| Q |
247 |
gcct |
250 |
Q |
| |
|
|||| |
|
|
| T |
26953941 |
gcct |
26953938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 171 - 233
Target Start/End: Complemental strand, 10623301 - 10623239
Alignment:
| Q |
171 |
ataggatggaggttttctggggtaccaacctagttgggatgttggtgttttctcttgatgcat |
233 |
Q |
| |
|
|||||||||||||| | ||||| ||||||||||| |||||| ||||||| |||||||||||| |
|
|
| T |
10623301 |
ataggatggaggttccccggggtgccaacctagttaggatgtcggtgtttcctcttgatgcat |
10623239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 163 - 230
Target Start/End: Complemental strand, 1051391 - 1051324
Alignment:
| Q |
163 |
ttggcagcataggatggaggttttctggggtaccaacctagttgggatgttggtgttttctcttgatg |
230 |
Q |
| |
|
||||| || |||||||||||||| | | ||| |||||||||||||||||| |||||| ||||||||| |
|
|
| T |
1051391 |
ttggcggcttaggatggaggtttcccgaggtgccaacctagttgggatgtcggtgttccctcttgatg |
1051324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 163 - 212
Target Start/End: Complemental strand, 16309739 - 16309690
Alignment:
| Q |
163 |
ttggcagcataggatggaggttttctggggtaccaacctagttgggatgt |
212 |
Q |
| |
|
||||| |||||||||||||||| || ||||| ||||| |||||||||||| |
|
|
| T |
16309739 |
ttggcggcataggatggaggttctccggggtgccaacttagttgggatgt |
16309690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 163 - 212
Target Start/End: Complemental strand, 18490733 - 18490684
Alignment:
| Q |
163 |
ttggcagcataggatggaggttttctggggtaccaacctagttgggatgt |
212 |
Q |
| |
|
||||| |||||||||||||||| || ||||| ||||| |||||||||||| |
|
|
| T |
18490733 |
ttggcggcataggatggaggttctccggggtgccaacttagttgggatgt |
18490684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 163 - 212
Target Start/End: Complemental strand, 19826486 - 19826437
Alignment:
| Q |
163 |
ttggcagcataggatggaggttttctggggtaccaacctagttgggatgt |
212 |
Q |
| |
|
||||| |||||||| |||||||| |||||| |||||||||||||||||| |
|
|
| T |
19826486 |
ttggcggcataggacggaggtttcttggggtgccaacctagttgggatgt |
19826437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 148 - 212
Target Start/End: Original strand, 26430245 - 26430310
Alignment:
| Q |
148 |
aataatattttagagtt-ggcagcataggatggaggttttctggggtaccaacctagttgggatgt |
212 |
Q |
| |
|
|||||| |||||||||| ||| ||||||||||||||| || ||||| ||||||||||| |||||| |
|
|
| T |
26430245 |
aataattttttagagtttggcggcataggatggaggtattacggggtgccaacctagttaggatgt |
26430310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 163 - 233
Target Start/End: Complemental strand, 2259471 - 2259401
Alignment:
| Q |
163 |
ttggcagcataggatggaggttttctggggtaccaacctagttgggatgttggtgttttctcttgatgcat |
233 |
Q |
| |
|
||||| ||||||||||||||||| | ||| | |||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
2259471 |
ttggctgcataggatggaggtttcccgggatgccaacctagttgggatgtcggtgtttcctcttgatgcat |
2259401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 155 - 231
Target Start/End: Complemental strand, 21711621 - 21711544
Alignment:
| Q |
155 |
ttttagag-ttggcagcataggatggaggttttctggggtaccaacctagttgggatgttggtgttttctcttgatgc |
231 |
Q |
| |
|
|||||||| ||||| |||||||||||||| || | ||||| |||||||||||||||||| |||||| |||||||||| |
|
|
| T |
21711621 |
ttttagagattggcggcataggatggagggttcccggggtgccaacctagttgggatgtcggtgttccctcttgatgc |
21711544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 169 - 231
Target Start/End: Original strand, 15614747 - 15614809
Alignment:
| Q |
169 |
gcataggatggaggttttctggggtaccaacctagttgggatgttggtgttttctcttgatgc |
231 |
Q |
| |
|
|||||||||||||| || | ||||| |||||||||||||||||| |||||| |||||||||| |
|
|
| T |
15614747 |
gcataggatggagggttcccggggtgccaacctagttgggatgtcggtgttccctcttgatgc |
15614809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 196 - 250
Target Start/End: Original strand, 24122975 - 24123029
Alignment:
| Q |
196 |
caacctagttgggatgttggtgttttctcttgatgcatatcccttctccttgcct |
250 |
Q |
| |
|
||||||||||| ||||| ||||||| ||||||||| | |||||||||||||||| |
|
|
| T |
24122975 |
caacctagttgagatgtcggtgtttcctcttgatgtctgtcccttctccttgcct |
24123029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 7)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 155 - 248
Target Start/End: Complemental strand, 44673758 - 44673664
Alignment:
| Q |
155 |
ttttagagtt-ggcagcataggatggaggttttctggggtaccaacctagttgggatgttggtgttttctcttgatgcatatcccttctccttgc |
248 |
Q |
| |
|
|||||||||| ||| ||||||||||||| |||| ||||| |||||||||||||||||| | |||| ||||||||| ||||| |||||||||| |
|
|
| T |
44673758 |
ttttagagtttggcggcataggatggagattttgcggggtgccaacctagttgggatgtcgatgttgcctcttgatgtctatccattctccttgc |
44673664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 148 - 250
Target Start/End: Complemental strand, 11416065 - 11415962
Alignment:
| Q |
148 |
aataatattttagagtt-ggcagcataggatggaggttttctggggtaccaacctagttgggatgttggtgttttctcttgatgcatatcccttctcctt |
246 |
Q |
| |
|
||||| ||||||||||| |||||||||| |||| ||||||| |||| ||||| |||||||||||| ||||||| || |||||| | ||| ||||||| |
|
|
| T |
11416065 |
aataaaattttagagtttggcagcatagaatgggggttttccagggtgccaacttagttgggatgtcggtgtttccttttgatgtttgtcctctctcctt |
11415966 |
T |
 |
| Q |
247 |
gcct |
250 |
Q |
| |
|
|||| |
|
|
| T |
11415965 |
gcct |
11415962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 171 - 233
Target Start/End: Complemental strand, 34657979 - 34657917
Alignment:
| Q |
171 |
ataggatggaggttttctggggtaccaacctagttgggatgttggtgttttctcttgatgcat |
233 |
Q |
| |
|
||||||| |||||| | ||||| |||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
34657979 |
ataggatagaggttccccggggtgccaacctagttgggatgtcggtgtttcctcttgatgcat |
34657917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 148 - 248
Target Start/End: Complemental strand, 8667187 - 8667087
Alignment:
| Q |
148 |
aataatattttagagtt-ggcagcataggatggaggttttctggggtaccaacctagttgggatgttggtgttttctcttgatgcatatcccttctcctt |
246 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||| ||||| ||| ||||||||||| |||||| | |||| |||||||||| | ||| ||||||| |
|
|
| T |
8667187 |
aataatattttagagtttggcggcataggatggagg-tttctcggggtccaacctagttaggatgtcgatgttgcctcttgatgcctgtccactctcctt |
8667089 |
T |
 |
| Q |
247 |
gc |
248 |
Q |
| |
|
|| |
|
|
| T |
8667088 |
gc |
8667087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 148 - 229
Target Start/End: Complemental strand, 33040664 - 33040582
Alignment:
| Q |
148 |
aataatattttagagttgg-cagcataggatggaggttttctggggtaccaacctagttgggatgttggtgttttctcttgat |
229 |
Q |
| |
|
||||| ||||||||||| | | ||||| ||||||||||| ||||| |||||||||||||||||| | |||| ||||||||| |
|
|
| T |
33040664 |
aataaaattttagagtttgacggcatatgatggaggtttctcggggtgccaacctagttgggatgtcgatgttgtctcttgat |
33040582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 171 - 233
Target Start/End: Complemental strand, 37005967 - 37005905
Alignment:
| Q |
171 |
ataggatggaggttttctggggtaccaacctagttgggatgttggtgttttctcttgatgcat |
233 |
Q |
| |
|
||||||| |||||| || ||||| |||||||| ||||||||| |||| || |||||||||||| |
|
|
| T |
37005967 |
ataggatagaggttctccggggtgccaacctaattgggatgtcggtgcttcctcttgatgcat |
37005905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 170 - 231
Target Start/End: Complemental strand, 19904680 - 19904619
Alignment:
| Q |
170 |
cataggatggaggttttctggggtaccaacctagttgggatgttggtgttttctcttgatgc |
231 |
Q |
| |
|
|||||||||||||| | |||||| |||||||||||||||||| | || | ||||||||||| |
|
|
| T |
19904680 |
cataggatggaggtctcttggggtgccaacctagttgggatgtcgatgatgtctcttgatgc |
19904619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0068 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0068
Description:
Target: scaffold0068; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 155 - 231
Target Start/End: Original strand, 2289 - 2366
Alignment:
| Q |
155 |
ttttagag-ttggcagcataggatggaggttttctggggtaccaacctagttgggatgttggtgttttctcttgatgc |
231 |
Q |
| |
|
|||||||| ||||| |||||||||||||| || | ||||| |||||||||||||||||| |||||| |||||||||| |
|
|
| T |
2289 |
ttttagagattggcggcataggatggagggttcccggggtgccaacctagttgggatgtcggtgttccctcttgatgc |
2366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 38; Significance: 0.000000000002; HSPs: 9)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 154 - 250
Target Start/End: Complemental strand, 1538042 - 1537945
Alignment:
| Q |
154 |
attttagagtt-ggcagcataggatggaggttttctggggtaccaacctagttgggatgttggtgttttctcttgatgcatatcccttctccttgcct |
250 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||| | ||| ||||||||||||||||| ||||||| ||||||||| | ||||| |||||||||| |
|
|
| T |
1538042 |
attttagagtttggcggcataggatggaggtttccctaggtggcaacctagttgggatgtcggtgtttcctcttgatgtctgtccctactccttgcct |
1537945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 148 - 250
Target Start/End: Original strand, 1633292 - 1633395
Alignment:
| Q |
148 |
aataatattttagagtt-ggcagcataggatggaggttttctggggtaccaacctagttgggatgttggtgttttctcttgatgcatatcccttctcctt |
246 |
Q |
| |
|
||||| ||||||||||| ||| ||||||||| ||||||| ||||| |||||||||||| ||| ||||||| |||||||||||| ||| ||||||| |
|
|
| T |
1633292 |
aataaaattttagagtttggcggcataggattgaggtttctcggggtgtcaacctagttggattgtcggtgtttcctcttgatgcatgtcctctctcctt |
1633391 |
T |
 |
| Q |
247 |
gcct |
250 |
Q |
| |
|
|||| |
|
|
| T |
1633392 |
gcct |
1633395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 163 - 212
Target Start/End: Complemental strand, 1862401 - 1862352
Alignment:
| Q |
163 |
ttggcagcataggatggaggttttctggggtaccaacctagttgggatgt |
212 |
Q |
| |
|
||||| |||||||||||||||| || ||||| |||||||||||||||||| |
|
|
| T |
1862401 |
ttggcggcataggatggaggttctccggggtgccaacctagttgggatgt |
1862352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 169 - 218
Target Start/End: Complemental strand, 4407477 - 4407428
Alignment:
| Q |
169 |
gcataggatggaggttttctggggtaccaacctagttgggatgttggtgt |
218 |
Q |
| |
|
|||||||| ||||| |||||||||| |||||||||||||||||| ||||| |
|
|
| T |
4407477 |
gcataggacggaggctttctggggtgccaacctagttgggatgtcggtgt |
4407428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 169 - 212
Target Start/End: Complemental strand, 4463498 - 4463455
Alignment:
| Q |
169 |
gcataggatggaggttttctggggtaccaacctagttgggatgt |
212 |
Q |
| |
|
|||||||||||||| || ||||||| |||||||||||||||||| |
|
|
| T |
4463498 |
gcataggatggaggcttcctggggtgccaacctagttgggatgt |
4463455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 169 - 219
Target Start/End: Original strand, 11842765 - 11842815
Alignment:
| Q |
169 |
gcataggatggaggttttctggggtaccaacctagttgggatgttggtgtt |
219 |
Q |
| |
|
||||||| |||||| || | |||||||||||||||||||||||| |||||| |
|
|
| T |
11842765 |
gcatagggtggaggcttcccggggtaccaacctagttgggatgtcggtgtt |
11842815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 163 - 212
Target Start/End: Original strand, 980923 - 980972
Alignment:
| Q |
163 |
ttggcagcataggatggaggttttctggggtaccaacctagttgggatgt |
212 |
Q |
| |
|
||||| |||||||||||||||| || || || |||||||||||||||||| |
|
|
| T |
980923 |
ttggcggcataggatggaggttctccggagtgccaacctagttgggatgt |
980972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 162 - 231
Target Start/End: Original strand, 12163398 - 12163467
Alignment:
| Q |
162 |
gttggcagcataggatggaggttttctggggtaccaacctagttgggatgttggtgttttctcttgatgc |
231 |
Q |
| |
|
|||||| ||| | ||||||||||| | | ||| |||||||||||||||||| |||||| |||||||||| |
|
|
| T |
12163398 |
gttggcggcagacgatggaggtttcccgaggtgccaacctagttgggatgtcggtgttgcctcttgatgc |
12163467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 169 - 218
Target Start/End: Original strand, 28937358 - 28937407
Alignment:
| Q |
169 |
gcataggatggaggttttctggggtaccaacctagttgggatgttggtgt |
218 |
Q |
| |
|
|||||||||||||| |||| ||| | |||||||||||||||||| ||||| |
|
|
| T |
28937358 |
gcataggatggaggctttccgggatgccaacctagttgggatgtcggtgt |
28937407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0437 (Bit Score: 37; Significance: 0.000000000009; HSPs: 1)
Name: scaffold0437
Description:
Target: scaffold0437; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 155 - 230
Target Start/End: Original strand, 11409 - 11485
Alignment:
| Q |
155 |
ttttagag-ttggcagcataggatggaggttttctggggtaccaacctagttgggatgttggtgttttctcttgatg |
230 |
Q |
| |
|
|||||||| ||||| |||||||||||||| || | ||||| |||||||||||||||||| |||||| ||||||||| |
|
|
| T |
11409 |
ttttagagattggcggcataggatggagggttcccggggtgccaacctagttgggatgtcggtgttccctcttgatg |
11485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0291 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: scaffold0291
Description:
Target: scaffold0291; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 15786 - 15742
Alignment:
| Q |
1 |
tatggatttcttttgtgacaaaattggtttgcctaactacaggtt |
45 |
Q |
| |
|
||||||||||||| |||||| | |||||||||||||||||||||| |
|
|
| T |
15786 |
tatggatttctttcgtgacatagttggtttgcctaactacaggtt |
15742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0291; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 148 - 230
Target Start/End: Complemental strand, 15640 - 15557
Alignment:
| Q |
148 |
aataatattttagagtt-ggcagcataggatggaggttttctggggtaccaacctagttgggatgttggtgttttctcttgatg |
230 |
Q |
| |
|
||||| ||||||||||| ||| |||||||| |||| ||| || |||| ||||||| ||||| |||| ||||||||||| ||||| |
|
|
| T |
15640 |
aataaaattttagagtttggcggcataggacggagatttcctagggtgccaacctggttggaatgtcggtgttttctcctgatg |
15557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0013 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0013
Description:
Target: scaffold0013; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 99464 - 99508
Alignment:
| Q |
1 |
tatggatttcttttgtgacaaaattggtttgcctaactacaggtt |
45 |
Q |
| |
|
||||||||||||| |||||| | |||||||||||||||||||||| |
|
|
| T |
99464 |
tatggatttctttcgtgacagagttggtttgcctaactacaggtt |
99508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0911 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: scaffold0911
Description:
Target: scaffold0911; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 148 - 230
Target Start/End: Complemental strand, 2309 - 2226
Alignment:
| Q |
148 |
aataatattttagagtt-ggcagcataggatggaggttttctggggtaccaacctagttgggatgttggtgttttctcttgatg |
230 |
Q |
| |
|
||||| ||||||||||| ||| ||||||||||||||||| | ||||| |||| |||||||| | || ||||||| || |||||| |
|
|
| T |
2309 |
aataaaattttagagtttggcggcataggatggaggtttcccggggtgccaatctagttggaacgtcggtgtttccttttgatg |
2226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0886 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: scaffold0886
Description:
Target: scaffold0886; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 163 - 230
Target Start/End: Original strand, 2786 - 2853
Alignment:
| Q |
163 |
ttggcagcataggatggaggttttctggggtaccaacctagttgggatgttggtgttttctcttgatg |
230 |
Q |
| |
|
||||| ||||||||||||||||| | |||||||||||||||||||||| | |||| ||||||||| |
|
|
| T |
2786 |
ttggcggcataggatggaggtttctcgaggtaccaacctagttgggatgtcgatgttgcctcttgatg |
2853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176 (Bit Score: 31; Significance: 0.00000003; HSPs: 2)
Name: scaffold0176
Description:
Target: scaffold0176; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 149 - 250
Target Start/End: Original strand, 26441 - 26542
Alignment:
| Q |
149 |
ataatattttagagttgg-cagcataggatggaggttttctggggtaccaacctagttgggatgttggtgttttctcttgatgcatatcccttctccttg |
247 |
Q |
| |
|
|||||||||||||||| | | | ||||||||||||||| | ||| | |||||||| | ||||||||||||||| |||| ||||||| ||| |||| ||| |
|
|
| T |
26441 |
ataatattttagagtttgacggtataggatggaggtttcccgggatgccaacctaat-gggatgttggtgtttcctctcgatgcatgtcctctctctttg |
26539 |
T |
 |
| Q |
248 |
cct |
250 |
Q |
| |
|
||| |
|
|
| T |
26540 |
cct |
26542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 86 - 131
Target Start/End: Original strand, 26376 - 26423
Alignment:
| Q |
86 |
ttattttcttctg--ggttttgatctagtcccccctcttcttgtatat |
131 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
26376 |
ttattttcttctgagggttttggcctagtcccccctcttcttgtatat |
26423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0257 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0257
Description:
Target: scaffold0257; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 196 - 245
Target Start/End: Original strand, 16233 - 16282
Alignment:
| Q |
196 |
caacctagttgggatgttggtgttttctcttgatgcatatcccttctcct |
245 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| ||| ||| ||||||| |
|
|
| T |
16233 |
caacctagttgggatgtcggtgctttctcttgatacatgtcctttctcct |
16282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0045 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0045
Description:
Target: scaffold0045; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 169 - 233
Target Start/End: Original strand, 80345 - 80409
Alignment:
| Q |
169 |
gcataggatggaggttttctggggtaccaacctagttgggatgttggtgttttctcttgatgcat |
233 |
Q |
| |
|
||||||||||||| ||| ||||| |||||||||||||||||||| ||||| | ||||||||| |
|
|
| T |
80345 |
gcataggatggagatttcgcggggtgccaacctagttgggatgttgctgtttcatgttgatgcat |
80409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University