View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8182_high_4 (Length: 238)
Name: NF8182_high_4
Description: NF8182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8182_high_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 18 - 221
Target Start/End: Original strand, 37983844 - 37984047
Alignment:
| Q |
18 |
caatgatgtgtaaaacattacagctatacctccttccacacaacttgatttaccacatgcttttggatgtaaattgtccaatgcagcttgaactgtgatc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37983844 |
caatgatgtgtaaaacattacagctatacctccttccacacaacttgatttaccacatgcttttggatgtaaattgtccaatgcagcttgaactgtgatc |
37983943 |
T |
|
| Q |
118 |
attaccaaagcctagacaatacaagtattaaaattaatatcattattaaactctctaaaccaaatgnnnnnnnctttattttatgtaattggaacatggc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
37983944 |
attaccaaagcctagacaatacaagtattaaaattaatatcattattaacctctctaaaccatatgtttttttctttattttatgtaattggaacatggc |
37984043 |
T |
|
| Q |
218 |
attg |
221 |
Q |
| |
|
|||| |
|
|
| T |
37984044 |
attg |
37984047 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 21 - 91
Target Start/End: Complemental strand, 45659603 - 45659533
Alignment:
| Q |
21 |
tgatgtgtaaaacattacagctatacctccttccacacaacttgatttaccacatgcttttggatgtaaat |
91 |
Q |
| |
|
||||||||||||||| | |||| || |||| ||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
45659603 |
tgatgtgtaaaacatgaattctattccacctttcacacaacttgatttcccacatgcatttggatgtaaat |
45659533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University