View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8183_low_14 (Length: 240)
Name: NF8183_low_14
Description: NF8183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8183_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 32 - 216
Target Start/End: Complemental strand, 30337921 - 30337737
Alignment:
| Q |
32 |
aagagtgctcatgtgacaagttcaaacaagattttagtcaacatatatatttttgattaattttattcattgatataaaatgctaagattttcatcttat |
131 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
30337921 |
aagagtgcttatgtgacaagttcaaacaagattttagtcaacatatatatttttgattaattttattgattgatataaaatgctaagattttcatcttat |
30337822 |
T |
 |
| Q |
132 |
ttccctcaccgttttcatcttcttcaaatccattaaaatttatgttgaaaataggtttcaaacctataaaactccttttctattt |
216 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30337821 |
ttccttcaccgttttcatcttcttcaaatccattaaaatttatgttgaaaataggtttcaaacctataaaactccttttctattt |
30337737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University