View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8183_low_6 (Length: 272)
Name: NF8183_low_6
Description: NF8183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8183_low_6 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 257
Target Start/End: Complemental strand, 9985503 - 9985247
Alignment:
| Q |
1 |
acttggtcactctagggaaagacatggaacataaggtatacatgaagtgcataccccatttacatttttgcatgatgcatgaatttcctctcctatagaa |
100 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
9985503 |
acttggtcactctagagaaagacatggaacataaggtatgcatgaagtgcatactccatttacatttttgcatgatgcatgaacttcctctcctatagaa |
9985404 |
T |
|
| Q |
101 |
gatgttatgttaatcccttcaagtataatgtttgtgcaagttatggcttcatcacaatgtaattgaattacatctttagcaatagatgttcctcttatgt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
9985403 |
gatgttatgttaatcccttcaagtataatgtttgtgcaagttatgtcttcatcacaatgtaattgaattgcatgtttagcaatagatgttcctcttatgt |
9985304 |
T |
|
| Q |
201 |
tgcggaaagttacatcacttactttcactgcatatacactatcatatgggttgtatt |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
9985303 |
tgcggaaagttacatcacttactttcactgcatatgcactatcatatgggttgtatt |
9985247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University