View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8184_low_11 (Length: 240)
Name: NF8184_low_11
Description: NF8184
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8184_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 4 - 223
Target Start/End: Original strand, 3224681 - 3224900
Alignment:
| Q |
4 |
cataaaaaagtacagtataaatgtatcactcattctcaacacctaacagtcagaactatttatggattttgcaatgacttaacatactaacttatgctag |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3224681 |
cataaaaaagtacagtataaatgtatcactcgttctcaacacctaacattcagaactatttatggattttgcaatgacttaacatactaacttatgctag |
3224780 |
T |
|
| Q |
104 |
attgccagagaaattatcagccaacatatttaagacctgtttggtttttaataaacaaatgttagtagattaatgattgtgttagttttcagggttcaac |
203 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3224781 |
attgacagagaaattatcagccaacatatttaagacctgcttggtttttaataaacaaatgttagtagattaatgattgtgttagttttcagggttcaac |
3224880 |
T |
|
| Q |
204 |
tcttatgcgtcccttagctc |
223 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
3224881 |
tcttatgcgtcccttagctc |
3224900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 97 - 150
Target Start/End: Original strand, 26615787 - 26615840
Alignment:
| Q |
97 |
atgctagattgccagagaaattatcagccaacatatttaagacctgtttggttt |
150 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||| | || ||||||||||| |
|
|
| T |
26615787 |
atgctagattgccaaagaaattatcagctgacatattcaggatctgtttggttt |
26615840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University