View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8185_high_19 (Length: 307)
Name: NF8185_high_19
Description: NF8185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8185_high_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 13 - 274
Target Start/End: Original strand, 34380685 - 34380946
Alignment:
| Q |
13 |
tttggtgttaaccttaatcctctttctaagccttgtcatgtgtcttatactcttatccccaccatgtgctactatgaatttttacctgttaatagaagta |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34380685 |
tttggtgttaaccttaatcctctttctaagccttgtcatgtgtcttatactcttatccccaccatgtgctactatgaatttttacctgttaatagaagta |
34380784 |
T |
|
| Q |
113 |
actgtgaggtcaatggatcaattccaccatcaacaacaaaatctcttggtgagaaaaaatatcaagaggtggtggatcttgttgatgtcaagcttggtca |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34380785 |
actgtgaggtcaatggatcaattccaccatcaacaacaaaatctcttggtgagaaaaaatatcaagaggtggtggatcttgttgatgtcaagcttggtca |
34380884 |
T |
|
| Q |
213 |
agaatatgagcttgttgttactacttatgctggtgagtaattacaatttactatttaacttt |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34380885 |
agaatatgagcttgttgttactacttatgctggtgagtaaatacaatttactatttaacttt |
34380946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 51; Significance: 3e-20; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 176 - 246
Target Start/End: Complemental strand, 23955792 - 23955722
Alignment:
| Q |
176 |
aagaggtggtggatcttgttgatgtcaagcttggtcaagaatatgagcttgttgttactacttatgctggt |
246 |
Q |
| |
|
||||| |||| || |||||||||||||| |||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
23955792 |
aagagttggttgaacttgttgatgtcaaacttggtcaagaatatgagcttgttgtcactacttatgctggt |
23955722 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 13 - 113
Target Start/End: Complemental strand, 23955946 - 23955846
Alignment:
| Q |
13 |
tttggtgttaaccttaatcctctttctaagccttgtcatgtgtcttatactcttatccccaccatgtgctactatgaatttttacctgttaatagaagta |
112 |
Q |
| |
|
|||||||||||| | || ||||||| | | ||| || | |||||||| |||||||| || ||||||||||||| ||||||||| ||||| |||||||||| |
|
|
| T |
23955946 |
tttggtgttaacttgaaccctctttgtcaacctagtgaagtgtcttacactcttattcctaccatgtgctactttgaatttttgcctgtgaatagaagta |
23955847 |
T |
|
| Q |
113 |
a |
113 |
Q |
| |
|
| |
|
|
| T |
23955846 |
a |
23955846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University