View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8185_high_21 (Length: 286)
Name: NF8185_high_21
Description: NF8185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8185_high_21 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 1 - 277
Target Start/End: Original strand, 33206349 - 33206625
Alignment:
| Q |
1 |
atcgtgacatatctcttcatctccagaccgctccacctaacctcaaatccttccgataaaatagttgattggtttgtgaataattttttcaatccagaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
33206349 |
atcgtgacatatctcttcatctccacaccgctccacctaacctcaaatccttcctctaaagtatttgattggtttgtgaataattttttcaatccagaaa |
33206448 |
T |
 |
| Q |
101 |
ctgttatgttgtgtttactctcttaaacattaaaatccaccactctagtttttaatgctacgtatgatgtttgaggtttacccccaatgaggcagcttgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33206449 |
ctgttatgttgtgtttactctcttaaacattaaaatccaccactctagtttttaatgctaagtatgatgtttgaggtttacccccaatgaggcagcttgt |
33206548 |
T |
 |
| Q |
201 |
gaattcagaaatttataaactcaaatgaaaagagagtggatatggaagaggactaaactcatacaatagagtataat |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
33206549 |
gaattcagaaatttataaactcaaatgaaaagagagtggatgtggaagaggactaaactcatacaatagagtataat |
33206625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University