View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8185_high_22 (Length: 282)
Name: NF8185_high_22
Description: NF8185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8185_high_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 17 - 266
Target Start/End: Original strand, 18854370 - 18854619
Alignment:
| Q |
17 |
gtggggaactataccaaagaaattgtccttgagggtttaaaggttctgaatagtgtcttctaattgaggccccttcgtgagactccatgtgcgttactaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
18854370 |
gtggggaactataccaaagaaattgtccttgagggttgaaaggttctgaatagtgtcttctaattgaggccccttcgtgagactccatgtgagttactaa |
18854469 |
T |
 |
| Q |
117 |
tgcatgattgcttctgaaaacttggtcgcaaactctacatgcgaccgagtattgtacatcatgcctcttgttactaaattcattggccatggttgtgatg |
216 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
18854470 |
tgcacgattgcttctgaaaacttggtcgcaaactctacatgcgaccgagtattgtacatcatgcctcttgttactaaagtcattggccatggttgtgatg |
18854569 |
T |
 |
| Q |
217 |
gnnnnnnnggaattggaaaaactagggcaaaggagttgtgagacaaaaat |
266 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18854570 |
gaaaaaaaggaattggaaaaactagggcaaaggagttgtgagacaaaaat |
18854619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 93 - 209
Target Start/End: Complemental strand, 15547749 - 15547633
Alignment:
| Q |
93 |
gtgagactccatgtgcgttactaatgcatgattgcttctgaaaacttggtcgcaaactctacatgcgaccgagtattgtacatcatgcctcttgttacta |
192 |
Q |
| |
|
||||||||| ||||| ||||| ||||| ||| ||||| |||||||| ||| ||| | ||||||||| ||||||| | |||||||||||| |||||||| |
|
|
| T |
15547749 |
gtgagactcgatgtgagttacgaatgcttgactgcttatgaaaactcggttgcataatctacatgcaaccgagtttaacacatcatgcctcgtgttacta |
15547650 |
T |
 |
| Q |
193 |
aattcattggccatggt |
209 |
Q |
| |
|
|| |||||| |||||| |
|
|
| T |
15547649 |
aagccattggtcatggt |
15547633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University