View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8185_high_8 (Length: 457)
Name: NF8185_high_8
Description: NF8185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8185_high_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 161; Significance: 1e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 161; E-Value: 1e-85
Query Start/End: Original strand, 237 - 433
Target Start/End: Complemental strand, 41060309 - 41060113
Alignment:
| Q |
237 |
atcgagtggatattgggattagagttcaagcaagttatcgttactctgggtgattgagatttgacacggaggccactgatcatgtcacattttctcttac |
336 |
Q |
| |
|
||||||||||||| || |||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41060309 |
atcgagtggatatgggaattagagttcaagcaagttatcgttactctaggtgattgacatttgacacggaggccactgatcatgtcacattttctcttac |
41060210 |
T |
|
| Q |
337 |
aaatttcacaacttatcaaactataaaaccgtttactacgagattaccaaatggttttcacaccacttttaatatttctggttcagttaatttatct |
433 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
41060209 |
aaatttcacagcttatcaaactataaaaccatttactacgagattaccaaatggttttcacaccactattaccatttctggttcagttaatttatct |
41060113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University