View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8185_low_19 (Length: 340)
Name: NF8185_low_19
Description: NF8185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8185_low_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 11 - 319
Target Start/End: Original strand, 22644604 - 22644912
Alignment:
| Q |
11 |
gagtgagatgaacaaaggattgtgagtgaatcggagcatgtgattaaatcagtcctatccatgtattatgacgtatggaaaaataggaacaagagtgctt |
110 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22644604 |
gagtgggatgaacaagggattgtgagtgaatcggagcatgtgattaaatcagtcctatccatgtattatgacgtatggaaaaataggaacaagagtgctt |
22644703 |
T |
|
| Q |
111 |
tgacggatatgatattcccggtgcagcagacgggggttagggactgtcggcagtaactcgtgatgctgacagagtagttgaacttgttgctctgaactgc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22644704 |
tgacggatatgatattcccggtgcagcagacgggggttagggactgtcagcagtaactcgtgatgctgacagagtagttgaacttgttgctctgaactgc |
22644803 |
T |
|
| Q |
211 |
tgtaaaaacatgatgtggacgggctatgtcaatgaaggctggactgcaatttgtaagggagatactctttttaaatttatttgccgaatctgattctcta |
310 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22644804 |
tgtaaaaacatgatgtggacgggctatggcaatgaaggctggactgaaatttgtaagggagatactctttttaaatttatttgccgaatctgattctcta |
22644903 |
T |
|
| Q |
311 |
tattggatt |
319 |
Q |
| |
|
||||||||| |
|
|
| T |
22644904 |
tattggatt |
22644912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University